ID: 1133404584

View in Genome Browser
Species Human (GRCh38)
Location 16:5513057-5513079
Sequence AGGCGTGCACTACCATGCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133404578_1133404584 5 Left 1133404578 16:5513029-5513051 CCTCAGCCTTACAAATAGCCAGG No data
Right 1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG No data
1133404577_1133404584 8 Left 1133404577 16:5513026-5513048 CCACCTCAGCCTTACAAATAGCC No data
Right 1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG No data
1133404576_1133404584 12 Left 1133404576 16:5513022-5513044 CCTTCCACCTCAGCCTTACAAAT No data
Right 1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG No data
1133404581_1133404584 -1 Left 1133404581 16:5513035-5513057 CCTTACAAATAGCCAGGAAGGCA No data
Right 1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG No data
1133404575_1133404584 28 Left 1133404575 16:5513006-5513028 CCTAGGCTCAAACGATCCTTCCA 0: 9
1: 267
2: 3329
3: 19104
4: 51580
Right 1133404584 16:5513057-5513079 AGGCGTGCACTACCATGCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133404584 Original CRISPR AGGCGTGCACTACCATGCAT AGG Intergenic
No off target data available for this crispr