ID: 1133406142

View in Genome Browser
Species Human (GRCh38)
Location 16:5526060-5526082
Sequence CTGTCTACACATGCACTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133406142_1133406147 14 Left 1133406142 16:5526060-5526082 CCAGGCAGTGCATGTGTAGACAG No data
Right 1133406147 16:5526097-5526119 TTTTATTTTCTCAGCCTCCTTGG No data
1133406142_1133406148 23 Left 1133406142 16:5526060-5526082 CCAGGCAGTGCATGTGTAGACAG No data
Right 1133406148 16:5526106-5526128 CTCAGCCTCCTTGGCTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133406142 Original CRISPR CTGTCTACACATGCACTGCC TGG (reversed) Intergenic
No off target data available for this crispr