ID: 1133410154

View in Genome Browser
Species Human (GRCh38)
Location 16:5561561-5561583
Sequence CCTATTAGACACCAGGGAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133410147_1133410154 -3 Left 1133410147 16:5561541-5561563 CCATTATGCAAAAGTCAGGCCCT No data
Right 1133410154 16:5561561-5561583 CCTATTAGACACCAGGGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133410154 Original CRISPR CCTATTAGACACCAGGGAAG GGG Intergenic
No off target data available for this crispr