ID: 1133411472

View in Genome Browser
Species Human (GRCh38)
Location 16:5572778-5572800
Sequence CTGTGGATATTTAGGGCAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133411468_1133411472 7 Left 1133411468 16:5572748-5572770 CCAAGACATAAAGAGGTGAGGGA No data
Right 1133411472 16:5572778-5572800 CTGTGGATATTTAGGGCAATCGG No data
1133411464_1133411472 29 Left 1133411464 16:5572726-5572748 CCTCACAGAGATAATATTTGAGC No data
Right 1133411472 16:5572778-5572800 CTGTGGATATTTAGGGCAATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133411472 Original CRISPR CTGTGGATATTTAGGGCAAT CGG Intergenic
No off target data available for this crispr