ID: 1133412243

View in Genome Browser
Species Human (GRCh38)
Location 16:5578462-5578484
Sequence ACCGTGGATGGGGTTTTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133412243_1133412248 -1 Left 1133412243 16:5578462-5578484 CCAGGAAAAACCCCATCCACGGT No data
Right 1133412248 16:5578484-5578506 TCTGACATTTAGAAATGTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133412243 Original CRISPR ACCGTGGATGGGGTTTTTCC TGG (reversed) Intergenic