ID: 1133412488

View in Genome Browser
Species Human (GRCh38)
Location 16:5580107-5580129
Sequence ACAGCTTGTAAGCCCCAAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133412483_1133412488 28 Left 1133412483 16:5580056-5580078 CCACTGCGCCCAGCTGGCAGTTA No data
Right 1133412488 16:5580107-5580129 ACAGCTTGTAAGCCCCAAGAGGG No data
1133412484_1133412488 20 Left 1133412484 16:5580064-5580086 CCCAGCTGGCAGTTAATTCTTTA No data
Right 1133412488 16:5580107-5580129 ACAGCTTGTAAGCCCCAAGAGGG No data
1133412485_1133412488 19 Left 1133412485 16:5580065-5580087 CCAGCTGGCAGTTAATTCTTTAT No data
Right 1133412488 16:5580107-5580129 ACAGCTTGTAAGCCCCAAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133412488 Original CRISPR ACAGCTTGTAAGCCCCAAGA GGG Intergenic
No off target data available for this crispr