ID: 1133412620

View in Genome Browser
Species Human (GRCh38)
Location 16:5580793-5580815
Sequence GCCCTACAGCTTCCTGGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133412620_1133412624 -6 Left 1133412620 16:5580793-5580815 CCAGACCCAGGAAGCTGTAGGGC No data
Right 1133412624 16:5580810-5580832 TAGGGCAGATGGCATTTACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133412620 Original CRISPR GCCCTACAGCTTCCTGGGTC TGG (reversed) Intergenic
No off target data available for this crispr