ID: 1133412620 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:5580793-5580815 |
Sequence | GCCCTACAGCTTCCTGGGTC TGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1133412620_1133412624 | -6 | Left | 1133412620 | 16:5580793-5580815 | CCAGACCCAGGAAGCTGTAGGGC | No data | ||
Right | 1133412624 | 16:5580810-5580832 | TAGGGCAGATGGCATTTACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1133412620 | Original CRISPR | GCCCTACAGCTTCCTGGGTC TGG (reversed) | Intergenic | ||
No off target data available for this crispr |