ID: 1133412667

View in Genome Browser
Species Human (GRCh38)
Location 16:5581120-5581142
Sequence GATCCAGAGGAGAAGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133412658_1133412667 10 Left 1133412658 16:5581087-5581109 CCACGTAGCCACCATTGTAGATG No data
Right 1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG No data
1133412660_1133412667 2 Left 1133412660 16:5581095-5581117 CCACCATTGTAGATGGCACTTGA No data
Right 1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG No data
1133412661_1133412667 -1 Left 1133412661 16:5581098-5581120 CCATTGTAGATGGCACTTGACAG No data
Right 1133412667 16:5581120-5581142 GATCCAGAGGAGAAGGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133412667 Original CRISPR GATCCAGAGGAGAAGGGGGC AGG Intergenic
No off target data available for this crispr