ID: 1133413525

View in Genome Browser
Species Human (GRCh38)
Location 16:5588198-5588220
Sequence CTGTGGGAATGGGGGGATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133413509_1133413525 27 Left 1133413509 16:5588148-5588170 CCACACAAATAAATCCATAAAGA No data
Right 1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG No data
1133413508_1133413525 28 Left 1133413508 16:5588147-5588169 CCCACACAAATAAATCCATAAAG No data
Right 1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG No data
1133413510_1133413525 13 Left 1133413510 16:5588162-5588184 CCATAAAGAAGAAAGTAGATCGG No data
Right 1133413525 16:5588198-5588220 CTGTGGGAATGGGGGGATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133413525 Original CRISPR CTGTGGGAATGGGGGGATGG GGG Intergenic
No off target data available for this crispr