ID: 1133417803

View in Genome Browser
Species Human (GRCh38)
Location 16:5619852-5619874
Sequence GGGGGCTCACTTCCTTCTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133417800_1133417803 -10 Left 1133417800 16:5619839-5619861 CCCCTGGGGACATGGGGGCTCAC No data
Right 1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG No data
1133417795_1133417803 1 Left 1133417795 16:5619828-5619850 CCTGGGCAGGTCCCCTGGGGACA No data
Right 1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG No data
1133417789_1133417803 18 Left 1133417789 16:5619811-5619833 CCGTGAAGGCAGTCAGACCTGGG No data
Right 1133417803 16:5619852-5619874 GGGGGCTCACTTCCTTCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133417803 Original CRISPR GGGGGCTCACTTCCTTCTCC TGG Intergenic
No off target data available for this crispr