ID: 1133429973

View in Genome Browser
Species Human (GRCh38)
Location 16:5728371-5728393
Sequence GCACGGACTCCTGTGTGCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133429969_1133429973 14 Left 1133429969 16:5728334-5728356 CCCTATTGTCAAAAGCTCTTAAG No data
Right 1133429973 16:5728371-5728393 GCACGGACTCCTGTGTGCAAAGG No data
1133429970_1133429973 13 Left 1133429970 16:5728335-5728357 CCTATTGTCAAAAGCTCTTAAGT No data
Right 1133429973 16:5728371-5728393 GCACGGACTCCTGTGTGCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133429973 Original CRISPR GCACGGACTCCTGTGTGCAA AGG Intergenic