ID: 1133430714

View in Genome Browser
Species Human (GRCh38)
Location 16:5734655-5734677
Sequence GTGTTTGGCACCAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133430714_1133430717 -8 Left 1133430714 16:5734655-5734677 CCTTCCTCTTTGGTGCCAAACAC No data
Right 1133430717 16:5734670-5734692 CCAAACACCCACATTGCTATTGG No data
1133430714_1133430718 -7 Left 1133430714 16:5734655-5734677 CCTTCCTCTTTGGTGCCAAACAC No data
Right 1133430718 16:5734671-5734693 CAAACACCCACATTGCTATTGGG No data
1133430714_1133430721 23 Left 1133430714 16:5734655-5734677 CCTTCCTCTTTGGTGCCAAACAC No data
Right 1133430721 16:5734701-5734723 TCTCAGATGACTTTACATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133430714 Original CRISPR GTGTTTGGCACCAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr