ID: 1133439128

View in Genome Browser
Species Human (GRCh38)
Location 16:5805916-5805938
Sequence AGTGGATCTGGGGGGACAAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133439119_1133439128 24 Left 1133439119 16:5805869-5805891 CCATCAATATGGTTTCAGGGCAC No data
Right 1133439128 16:5805916-5805938 AGTGGATCTGGGGGGACAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133439128 Original CRISPR AGTGGATCTGGGGGGACAAA TGG Intergenic
No off target data available for this crispr