ID: 1133439444

View in Genome Browser
Species Human (GRCh38)
Location 16:5808113-5808135
Sequence ATGTGACTATGTATGGAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133439439_1133439444 17 Left 1133439439 16:5808073-5808095 CCATTTCAAACGCTGAAGTCCTA No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439441_1133439444 -2 Left 1133439441 16:5808092-5808114 CCTAGCTCCTGGTATATCAGAAT No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439437_1133439444 23 Left 1133439437 16:5808067-5808089 CCAGTCCCATTTCAAACGCTGAA No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439438_1133439444 18 Left 1133439438 16:5808072-5808094 CCCATTTCAAACGCTGAAGTCCT No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439436_1133439444 24 Left 1133439436 16:5808066-5808088 CCCAGTCCCATTTCAAACGCTGA No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439435_1133439444 25 Left 1133439435 16:5808065-5808087 CCCCAGTCCCATTTCAAACGCTG No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data
1133439442_1133439444 -9 Left 1133439442 16:5808099-5808121 CCTGGTATATCAGAATGTGACTA No data
Right 1133439444 16:5808113-5808135 ATGTGACTATGTATGGAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133439444 Original CRISPR ATGTGACTATGTATGGAGAT AGG Intergenic
No off target data available for this crispr