ID: 1133441142

View in Genome Browser
Species Human (GRCh38)
Location 16:5821817-5821839
Sequence CTGCATCCTCACATGGTGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133441139_1133441142 7 Left 1133441139 16:5821787-5821809 CCTCTTAGCATCCAGGATGGTCT No data
Right 1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG No data
1133441138_1133441142 8 Left 1133441138 16:5821786-5821808 CCCTCTTAGCATCCAGGATGGTC No data
Right 1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG No data
1133441140_1133441142 -4 Left 1133441140 16:5821798-5821820 CCAGGATGGTCTCTTGCTGCTGC No data
Right 1133441142 16:5821817-5821839 CTGCATCCTCACATGGTGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133441142 Original CRISPR CTGCATCCTCACATGGTGAA AGG Intergenic
No off target data available for this crispr