ID: 1133442419

View in Genome Browser
Species Human (GRCh38)
Location 16:5831916-5831938
Sequence CTGAAATAGAGTTCGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133442413_1133442419 14 Left 1133442413 16:5831879-5831901 CCATGCTTGGATCTTGGTCACCC No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data
1133442412_1133442419 15 Left 1133442412 16:5831878-5831900 CCCATGCTTGGATCTTGGTCACC No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data
1133442416_1133442419 -8 Left 1133442416 16:5831901-5831923 CCAAGTTTCTACTGCCTGAAATA No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data
1133442414_1133442419 -6 Left 1133442414 16:5831899-5831921 CCCCAAGTTTCTACTGCCTGAAA No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data
1133442415_1133442419 -7 Left 1133442415 16:5831900-5831922 CCCAAGTTTCTACTGCCTGAAAT No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data
1133442411_1133442419 16 Left 1133442411 16:5831877-5831899 CCCCATGCTTGGATCTTGGTCAC No data
Right 1133442419 16:5831916-5831938 CTGAAATAGAGTTCGGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133442419 Original CRISPR CTGAAATAGAGTTCGGCACA TGG Intergenic
No off target data available for this crispr