ID: 1133448050

View in Genome Browser
Species Human (GRCh38)
Location 16:5879276-5879298
Sequence GATGGTAAGCAGAAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133448040_1133448050 16 Left 1133448040 16:5879237-5879259 CCAATGAGCAAATGCTGTGCTGG No data
Right 1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG No data
1133448039_1133448050 24 Left 1133448039 16:5879229-5879251 CCTGAGTTCCAATGAGCAAATGC No data
Right 1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG No data
1133448047_1133448050 -8 Left 1133448047 16:5879261-5879283 CCAGCAGGGGTTTCAGATGGTAA No data
Right 1133448050 16:5879276-5879298 GATGGTAAGCAGAAGCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133448050 Original CRISPR GATGGTAAGCAGAAGCTGGA GGG Intergenic
No off target data available for this crispr