ID: 1133449226

View in Genome Browser
Species Human (GRCh38)
Location 16:5889694-5889716
Sequence TAGCATGGGCTGCCACGGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133449226_1133449232 -1 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449232 16:5889716-5889738 AGAGGGATCTCACCTAGTCCTGG No data
1133449226_1133449236 6 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449236 16:5889723-5889745 TCTCACCTAGTCCTGGGGTTGGG No data
1133449226_1133449233 0 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449233 16:5889717-5889739 GAGGGATCTCACCTAGTCCTGGG No data
1133449226_1133449237 7 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449237 16:5889724-5889746 CTCACCTAGTCCTGGGGTTGGGG No data
1133449226_1133449241 22 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449241 16:5889739-5889761 GGTTGGGGAAGGCCTCTTTGAGG No data
1133449226_1133449235 5 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449235 16:5889722-5889744 ATCTCACCTAGTCCTGGGGTTGG No data
1133449226_1133449239 11 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449239 16:5889728-5889750 CCTAGTCCTGGGGTTGGGGAAGG No data
1133449226_1133449234 1 Left 1133449226 16:5889694-5889716 CCTGTCCGTGGCAGCCCATGCTA No data
Right 1133449234 16:5889718-5889740 AGGGATCTCACCTAGTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133449226 Original CRISPR TAGCATGGGCTGCCACGGAC AGG (reversed) Intergenic
No off target data available for this crispr