ID: 1133450993

View in Genome Browser
Species Human (GRCh38)
Location 16:5903909-5903931
Sequence CTGTCTTTGCTGAGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133450987_1133450993 7 Left 1133450987 16:5903879-5903901 CCTGCATGTGCTCACCAGAGCTG No data
Right 1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG No data
1133450989_1133450993 -7 Left 1133450989 16:5903893-5903915 CCAGAGCTGGCTTCCTCTGTCTT No data
Right 1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG No data
1133450986_1133450993 8 Left 1133450986 16:5903878-5903900 CCCTGCATGTGCTCACCAGAGCT No data
Right 1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG No data
1133450985_1133450993 24 Left 1133450985 16:5903862-5903884 CCTTGGTTGGTGCAAGCCCTGCA No data
Right 1133450993 16:5903909-5903931 CTGTCTTTGCTGAGGGAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133450993 Original CRISPR CTGTCTTTGCTGAGGGAAGC TGG Intergenic
No off target data available for this crispr