ID: 1133451618

View in Genome Browser
Species Human (GRCh38)
Location 16:5908895-5908917
Sequence TGCTGTGTCCTCACACAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133451618_1133451621 2 Left 1133451618 16:5908895-5908917 CCTCTCTGTGTGAGGACACAGCA No data
Right 1133451621 16:5908920-5908942 AAGCTGGCTGTCTGTCAACAGGG No data
1133451618_1133451622 3 Left 1133451618 16:5908895-5908917 CCTCTCTGTGTGAGGACACAGCA No data
Right 1133451622 16:5908921-5908943 AGCTGGCTGTCTGTCAACAGGGG No data
1133451618_1133451620 1 Left 1133451618 16:5908895-5908917 CCTCTCTGTGTGAGGACACAGCA No data
Right 1133451620 16:5908919-5908941 GAAGCTGGCTGTCTGTCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133451618 Original CRISPR TGCTGTGTCCTCACACAGAG AGG (reversed) Intergenic
No off target data available for this crispr