ID: 1133451899

View in Genome Browser
Species Human (GRCh38)
Location 16:5910852-5910874
Sequence CTTCCATCTGTCACGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133451899_1133451907 17 Left 1133451899 16:5910852-5910874 CCCTGTTCCGTGACAGATGGAAG No data
Right 1133451907 16:5910892-5910914 CACATCCCTCATCCTCTGGATGG No data
1133451899_1133451908 18 Left 1133451899 16:5910852-5910874 CCCTGTTCCGTGACAGATGGAAG No data
Right 1133451908 16:5910893-5910915 ACATCCCTCATCCTCTGGATGGG No data
1133451899_1133451903 13 Left 1133451899 16:5910852-5910874 CCCTGTTCCGTGACAGATGGAAG No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133451899 Original CRISPR CTTCCATCTGTCACGGAACA GGG (reversed) Intergenic
No off target data available for this crispr