ID: 1133451903

View in Genome Browser
Species Human (GRCh38)
Location 16:5910888-5910910
Sequence ACCCCACATCCCTCATCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133451899_1133451903 13 Left 1133451899 16:5910852-5910874 CCCTGTTCCGTGACAGATGGAAG No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data
1133451896_1133451903 25 Left 1133451896 16:5910840-5910862 CCCAGGAAAGCTCCCTGTTCCGT No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data
1133451900_1133451903 12 Left 1133451900 16:5910853-5910875 CCTGTTCCGTGACAGATGGAAGC No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data
1133451897_1133451903 24 Left 1133451897 16:5910841-5910863 CCAGGAAAGCTCCCTGTTCCGTG No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data
1133451895_1133451903 26 Left 1133451895 16:5910839-5910861 CCCCAGGAAAGCTCCCTGTTCCG No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data
1133451902_1133451903 6 Left 1133451902 16:5910859-5910881 CCGTGACAGATGGAAGCTGGTGT No data
Right 1133451903 16:5910888-5910910 ACCCCACATCCCTCATCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133451903 Original CRISPR ACCCCACATCCCTCATCCTC TGG Intergenic
No off target data available for this crispr