ID: 1133454897

View in Genome Browser
Species Human (GRCh38)
Location 16:5933478-5933500
Sequence ACAAGGAGATTCAACCCTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133454897_1133454901 10 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454901 16:5933511-5933533 TGAAAAACGGATGCTCCTGCAGG No data
1133454897_1133454904 25 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454904 16:5933526-5933548 CCTGCAGGGAAAAGTGACTTAGG No data
1133454897_1133454899 -3 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454899 16:5933498-5933520 TGTTTTCCTGATGTGAAAAACGG No data
1133454897_1133454902 11 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454902 16:5933512-5933534 GAAAAACGGATGCTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133454897 Original CRISPR ACAAGGAGATTCAACCCTGA CGG (reversed) Intergenic
No off target data available for this crispr