ID: 1133454898

View in Genome Browser
Species Human (GRCh38)
Location 16:5933495-5933517
Sequence TTTTTCACATCAGGAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133454898_1133454901 -7 Left 1133454898 16:5933495-5933517 CCTTGTTTTCCTGATGTGAAAAA No data
Right 1133454901 16:5933511-5933533 TGAAAAACGGATGCTCCTGCAGG No data
1133454898_1133454902 -6 Left 1133454898 16:5933495-5933517 CCTTGTTTTCCTGATGTGAAAAA No data
Right 1133454902 16:5933512-5933534 GAAAAACGGATGCTCCTGCAGGG No data
1133454898_1133454904 8 Left 1133454898 16:5933495-5933517 CCTTGTTTTCCTGATGTGAAAAA No data
Right 1133454904 16:5933526-5933548 CCTGCAGGGAAAAGTGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133454898 Original CRISPR TTTTTCACATCAGGAAAACA AGG (reversed) Intergenic
No off target data available for this crispr