ID: 1133454899

View in Genome Browser
Species Human (GRCh38)
Location 16:5933498-5933520
Sequence TGTTTTCCTGATGTGAAAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133454897_1133454899 -3 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454899 16:5933498-5933520 TGTTTTCCTGATGTGAAAAACGG No data
1133454891_1133454899 30 Left 1133454891 16:5933445-5933467 CCGTTTTGAGGGATCTCTTTAGG No data
Right 1133454899 16:5933498-5933520 TGTTTTCCTGATGTGAAAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133454899 Original CRISPR TGTTTTCCTGATGTGAAAAA CGG Intergenic
No off target data available for this crispr