ID: 1133454902

View in Genome Browser
Species Human (GRCh38)
Location 16:5933512-5933534
Sequence GAAAAACGGATGCTCCTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133454897_1133454902 11 Left 1133454897 16:5933478-5933500 CCGTCAGGGTTGAATCTCCTTGT No data
Right 1133454902 16:5933512-5933534 GAAAAACGGATGCTCCTGCAGGG No data
1133454898_1133454902 -6 Left 1133454898 16:5933495-5933517 CCTTGTTTTCCTGATGTGAAAAA No data
Right 1133454902 16:5933512-5933534 GAAAAACGGATGCTCCTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133454902 Original CRISPR GAAAAACGGATGCTCCTGCA GGG Intergenic
No off target data available for this crispr