ID: 1133456836

View in Genome Browser
Species Human (GRCh38)
Location 16:5949683-5949705
Sequence CTGCTGTTCTACAAAACAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133456836_1133456839 23 Left 1133456836 16:5949683-5949705 CCATTTGTTTTGTAGAACAGCAG No data
Right 1133456839 16:5949729-5949751 CAGCAGCAGCAGCATCAACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133456836 Original CRISPR CTGCTGTTCTACAAAACAAA TGG (reversed) Intergenic
No off target data available for this crispr