ID: 1133460410

View in Genome Browser
Species Human (GRCh38)
Location 16:5982234-5982256
Sequence TCCAGGGATGTTCCCACCAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133460403_1133460410 28 Left 1133460403 16:5982183-5982205 CCAAGCATGCTGAGAACCAGCTA No data
Right 1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG No data
1133460402_1133460410 29 Left 1133460402 16:5982182-5982204 CCCAAGCATGCTGAGAACCAGCT No data
Right 1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG No data
1133460407_1133460410 -3 Left 1133460407 16:5982214-5982236 CCAAGTTGTTTCTGGAATAGTCC No data
Right 1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG No data
1133460404_1133460410 12 Left 1133460404 16:5982199-5982221 CCAGCTACATTGCCGCCAAGTTG No data
Right 1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG No data
1133460406_1133460410 0 Left 1133460406 16:5982211-5982233 CCGCCAAGTTGTTTCTGGAATAG No data
Right 1133460410 16:5982234-5982256 TCCAGGGATGTTCCCACCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133460410 Original CRISPR TCCAGGGATGTTCCCACCAT AGG Intergenic
No off target data available for this crispr