ID: 1133461554

View in Genome Browser
Species Human (GRCh38)
Location 16:5990632-5990654
Sequence CGGTGTATGGGGAAGGTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133461547_1133461554 -7 Left 1133461547 16:5990616-5990638 CCTGGAAAAATAGTTGCGGTGTA No data
Right 1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG No data
1133461542_1133461554 23 Left 1133461542 16:5990586-5990608 CCCATGGACTATAGCTTTTTCAG No data
Right 1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG No data
1133461543_1133461554 22 Left 1133461543 16:5990587-5990609 CCATGGACTATAGCTTTTTCAGA No data
Right 1133461554 16:5990632-5990654 CGGTGTATGGGGAAGGTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133461554 Original CRISPR CGGTGTATGGGGAAGGTGGG TGG Intergenic
No off target data available for this crispr