ID: 1133463981

View in Genome Browser
Species Human (GRCh38)
Location 16:6012202-6012224
Sequence CCTCATCTGTAGAATGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133463978_1133463981 15 Left 1133463978 16:6012164-6012186 CCTTGGCGACTGTGAGCAAATGT No data
Right 1133463981 16:6012202-6012224 CCTCATCTGTAGAATGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133463981 Original CRISPR CCTCATCTGTAGAATGAGGA TGG Intergenic
No off target data available for this crispr