ID: 1133464737

View in Genome Browser
Species Human (GRCh38)
Location 16:6018967-6018989
Sequence CGCCAGCGCCGCCGCCGCCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133464737_1133464746 -7 Left 1133464737 16:6018967-6018989 CCGCGGCGGCGGCGGCGCTGGCG No data
Right 1133464746 16:6018983-6019005 GCTGGCGAGGGGAAGGGGGAGGG No data
1133464737_1133464745 -8 Left 1133464737 16:6018967-6018989 CCGCGGCGGCGGCGGCGCTGGCG No data
Right 1133464745 16:6018982-6019004 CGCTGGCGAGGGGAAGGGGGAGG No data
1133464737_1133464748 -5 Left 1133464737 16:6018967-6018989 CCGCGGCGGCGGCGGCGCTGGCG No data
Right 1133464748 16:6018985-6019007 TGGCGAGGGGAAGGGGGAGGGGG No data
1133464737_1133464751 24 Left 1133464737 16:6018967-6018989 CCGCGGCGGCGGCGGCGCTGGCG No data
Right 1133464751 16:6019014-6019036 CTCGCGCACCAGATTATTTTTGG No data
1133464737_1133464747 -6 Left 1133464737 16:6018967-6018989 CCGCGGCGGCGGCGGCGCTGGCG No data
Right 1133464747 16:6018984-6019006 CTGGCGAGGGGAAGGGGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133464737 Original CRISPR CGCCAGCGCCGCCGCCGCCG CGG (reversed) Intergenic
No off target data available for this crispr