ID: 1133465748

View in Genome Browser
Species Human (GRCh38)
Location 16:6025467-6025489
Sequence TCTGGGGCCTCCCTTCAAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 214}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133465743_1133465748 24 Left 1133465743 16:6025420-6025442 CCTGGGAGGATACATCTGTATAC 0: 1
1: 0
2: 0
3: 5
4: 106
Right 1133465748 16:6025467-6025489 TCTGGGGCCTCCCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 214
1133465744_1133465748 -4 Left 1133465744 16:6025448-6025470 CCTACTTAGATTTTCTTTCTCTG 0: 1
1: 1
2: 6
3: 79
4: 684
Right 1133465748 16:6025467-6025489 TCTGGGGCCTCCCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 214
1133465742_1133465748 25 Left 1133465742 16:6025419-6025441 CCCTGGGAGGATACATCTGTATA 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1133465748 16:6025467-6025489 TCTGGGGCCTCCCTTCAAAGAGG 0: 1
1: 0
2: 0
3: 11
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133465748 Original CRISPR TCTGGGGCCTCCCTTCAAAG AGG Intronic
903340135 1:22648731-22648753 CATGGGGCCTCCCTTCTACGAGG - Intergenic
903340629 1:22652236-22652258 CATGGGGCCTCCCTTCTACGGGG - Intergenic
903749840 1:25614889-25614911 TCTGGATCCTACCTTCACAGGGG + Intergenic
904302668 1:29565165-29565187 GCTAGGGCCTCCCTTCAATCTGG + Intergenic
906003289 1:42445808-42445830 TCTCTGGCCTCCCTCCAATGTGG - Intronic
911034730 1:93529064-93529086 TATGGAGCGTCCCTCCAAAGTGG - Intronic
913446506 1:118956012-118956034 TCTGGGGCCTCTTTTATAAGGGG - Intronic
920364458 1:205440690-205440712 GCTGGGGCCTCTCTCCAAGGAGG + Intronic
921938379 1:220815466-220815488 TCTGGGTGCTCCCTTCCACGTGG - Exonic
923217230 1:231859469-231859491 TCTGGGGCCTCTTTTGTAAGGGG + Intronic
1066055955 10:31680251-31680273 TCAAAGGCCTCACTTCAAAGTGG + Intergenic
1068207413 10:53873850-53873872 TCTGGGGCCTCTTTTCAAAAAGG - Intronic
1071485548 10:86099801-86099823 TCTGGGGTCTCCATGCACAGGGG + Intronic
1074575044 10:114660786-114660808 TCCAGAGCCTGCCTTCAAAGTGG - Intronic
1075052262 10:119191524-119191546 TCTGGGGCTCCTCTTCAATGAGG - Intergenic
1075223211 10:120602162-120602184 TCTGGCTCCTACCTTCAAAGTGG + Intergenic
1076055266 10:127367617-127367639 TCTGGGGCCTCCCATCTCACAGG - Intronic
1077591021 11:3491155-3491177 TGTGGCGACTCACTTCAAAGTGG + Intergenic
1082323597 11:51108900-51108922 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082326127 11:51145170-51145192 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082333652 11:51254483-51254505 TCTGTGGCCTTCCTTCGAAACGG + Intergenic
1082339335 11:51336951-51336973 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082347210 11:51451709-51451731 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082349856 11:51489955-51489977 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082360422 11:51643846-51643868 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082364551 11:51704027-51704049 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082382602 11:51965985-51966007 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082384225 11:51989779-51989801 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082392905 11:52116449-52116471 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082397491 11:52182899-52182921 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082401317 11:52238149-52238171 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082402013 11:52248349-52248371 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082408466 11:52341666-52341688 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082409771 11:52360368-52360390 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082418745 11:52489778-52489800 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082435903 11:52737978-52738000 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082444219 11:52857804-52857826 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082445914 11:52882461-52882483 TTTGTGGCCTCCCTTCGAAACGG + Intergenic
1082455497 11:53021880-53021902 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082457469 11:53050783-53050805 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082457944 11:53057587-53057609 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082464009 11:53145136-53145158 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082477889 11:53345979-53346001 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082481376 11:53396153-53396175 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082489888 11:53518560-53518582 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082492336 11:53553005-53553027 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082496316 11:53610823-53610845 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082502288 11:53697194-53697216 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082508014 11:53780506-53780528 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082509359 11:53800063-53800085 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082513745 11:53862991-53863013 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082514979 11:53880845-53880867 TTTGGGGCCTTCCTTCGAAAGGG + Intergenic
1082521043 11:53968436-53968458 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082525637 11:54035080-54035102 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082527440 11:54061249-54061271 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082530032 11:54098662-54098684 TTTGTGGCCTTCCTTCAAAAGGG + Intergenic
1082532390 11:54132681-54132703 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082539307 11:54233005-54233027 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082545531 11:54323301-54323323 TTTGGGGCCTTCCTTCGAAACGG + Intergenic
1082547023 11:54344665-54344687 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082548258 11:54361040-54361062 TTTGTGGCCTTCCTTCAAAACGG + Intergenic
1082554072 11:54538382-54538404 TCTGTGGCCTTCCTTCGAAGCGG + Intergenic
1084741193 11:71140557-71140579 ACCGGGGCCTCCCTTCTACGTGG + Intronic
1086794433 11:91083136-91083158 TCTGAGGCCTCCCATCCATGTGG + Intergenic
1091119773 11:133047224-133047246 TCTGGGGTTTCCCCTAAAAGTGG - Intronic
1092103477 12:5904420-5904442 TCTGTGGCTTCCCTTCCATGTGG - Intronic
1092145614 12:6212578-6212600 TCTGTGGCCTCCCTTTCCAGGGG - Intronic
1096590891 12:52658608-52658630 TCTGGAGCCTCTCCTGAAAGAGG - Intergenic
1103762965 12:123264767-123264789 CCTTGGGTCTCCCTCCAAAGAGG + Intronic
1105579016 13:21676284-21676306 ACTGGGGCTTCCATTCAAATTGG + Intronic
1106475796 13:30096947-30096969 GATTGGGCCTCCCTGCAAAGGGG + Intergenic
1111474194 13:88724821-88724843 TCTGGGGCCTCCCAGCCATGTGG + Intergenic
1112116423 13:96360219-96360241 TCTGTATCCTCCCTACAAAGTGG - Intronic
1113186964 13:107698808-107698830 TCTGGGTCTTGCCTTCAAAGGGG + Intronic
1113519001 13:110924975-110924997 TCTGGGCCATCCATTCAAGGGGG - Intergenic
1113778668 13:112963349-112963371 TCTGGGGCCTGGCATCAGAGCGG + Intronic
1115161248 14:30398193-30398215 TCTAGGACCACCCTTCAAACTGG - Intergenic
1119333634 14:73814394-73814416 TAAGGGGCCTCAATTCAAAGTGG - Intergenic
1122969888 14:105148245-105148267 TCTGGGGCCTGCCTGCTGAGCGG - Intronic
1123113826 14:105884965-105884987 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123116053 14:105894600-105894622 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123120295 14:105913314-105913336 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123403014 15:20004891-20004913 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1123512354 15:21011545-21011567 TCTGGGGCCCCCATTGACAGTGG + Intergenic
1127553618 15:60065598-60065620 TCTGAGGCTTCATTTCAAAGAGG + Intergenic
1127652283 15:61021063-61021085 TCTTGGTCCTCCCCTCAAGGTGG + Intronic
1128688420 15:69704826-69704848 TCTGGGGCCTTTTTTCAAAAGGG + Intergenic
1130776625 15:86990873-86990895 TCTGGGGCCTCACTTTAGAATGG + Intronic
1132330357 15:101008406-101008428 TCTCTGACCTCCCTTCAAGGCGG - Intronic
1132574543 16:658450-658472 CCTGGGGCCTCCCTTCGTTGTGG - Intronic
1132669735 16:1097722-1097744 TCTGGGACCTGCCCTCAAGGGGG - Intergenic
1132788969 16:1674441-1674463 GCTGGGGCCTCCCTGCAGAGAGG - Exonic
1132815758 16:1825936-1825958 GCTGGGGCCTCCCTTAGAATGGG + Intronic
1133203086 16:4216735-4216757 CCTGCTGCCTCCCTTCAGAGGGG + Intronic
1133399027 16:5471273-5471295 TCCTGAGCCTCTCTTCAAAGAGG - Intergenic
1133465748 16:6025467-6025489 TCTGGGGCCTCCCTTCAAAGAGG + Intronic
1134265971 16:12692852-12692874 TCTGGGGCCGCCCTGCCAGGTGG - Intronic
1135137554 16:19896140-19896162 TCTGGGGTCTCCTTTACAAGAGG - Intergenic
1136297162 16:29310110-29310132 TCTGGGGCCTCCCGTCCATGCGG + Intergenic
1139583270 16:67885529-67885551 TCTGGGTCCTACCTTGAAGGGGG + Intronic
1143954761 17:10659581-10659603 CCTGGTCCCTGCCTTCAAAGAGG + Intergenic
1144854370 17:18259963-18259985 TCTGGAGCCTCCCTTTGTAGGGG - Intergenic
1145449728 17:23228417-23228439 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145473101 17:23568404-23568426 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145477541 17:23633224-23633246 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145493591 17:23866306-23866328 TCTGTGGCCTTCCTTCGAAACGG + Intergenic
1145558799 17:24815104-24815126 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145572256 17:25010833-25010855 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145575873 17:25063582-25063604 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145589928 17:25267354-25267376 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145592474 17:25304502-25304524 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145595042 17:25342167-25342189 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145626127 17:25795217-25795239 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145626971 17:25807436-25807458 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145659292 17:26276319-26276341 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1145675550 17:26512936-26512958 TCTGTGGCCTTCGTTCAAAACGG + Intergenic
1147651147 17:42062705-42062727 TCTGTGGCCTCCCTCCATGGGGG - Intronic
1149666665 17:58369606-58369628 TCTGTGGCCTCCCTTCTAGCTGG - Intronic
1150386781 17:64767715-64767737 TCTAGGGCCACCCCTCCAAGTGG + Intergenic
1152265642 17:79292978-79293000 TCAGGGGCCTCTTTTCAAGGGGG - Intronic
1152567301 17:81106059-81106081 CCTGGGGCCTCTCTTCCAGGCGG + Exonic
1153880257 18:9416173-9416195 GCTGGGGAGGCCCTTCAAAGAGG + Intergenic
1157725405 18:49959956-49959978 TTTGGGGCCTGTCTGCAAAGGGG + Intronic
1160967370 19:1752662-1752684 CCTGGGGCTTCTCTTCAATGTGG - Exonic
1162433509 19:10643259-10643281 TCTGGGACCTCTCTCCACAGTGG + Exonic
1162543627 19:11314645-11314667 TCAGGGGCCTCCTTGCAGAGGGG + Intronic
1162811081 19:13164587-13164609 TCTGGGGAGCCCCTTCCAAGGGG - Intergenic
1165246959 19:34503347-34503369 ACTGGGGCCTGACTTCATAGAGG - Exonic
1166623654 19:44329316-44329338 TATAGGGCTTCCCTTCCAAGTGG + Exonic
1166764561 19:45245180-45245202 TCTGGGGCCTGACTCCAGAGGGG - Intronic
925952191 2:8925519-8925541 TCTAGGGCCTCATTTCTAAGAGG - Intronic
926374644 2:12214595-12214617 TCTGGGGTCTCCCCTGTAAGAGG + Intergenic
929599351 2:43195233-43195255 TCTGGGGCTTCCCCACAAACAGG - Intergenic
936579068 2:113680380-113680402 TCTGGGGTCTCTTTTCTAAGAGG + Intergenic
936579079 2:113680461-113680483 TCTGGGGTCTCTTTTCTAAGAGG + Intergenic
940291134 2:152078625-152078647 TCTGGGTCATCCCTTTAAAAAGG + Intronic
940770516 2:157834855-157834877 TCTGGGGTCTCTCTTATAAGGGG - Intronic
942541428 2:177018935-177018957 TCTGGGGACTCACTGCAGAGCGG - Intergenic
944591627 2:201223149-201223171 TCTGGGGCCTGCCTACAGAAAGG + Intronic
947640691 2:231706415-231706437 CCTGGGGCCGCCCTTCACAGAGG - Intergenic
948024400 2:234765333-234765355 GCTGGGGGCTGCCATCAAAGCGG - Intergenic
948126524 2:235568151-235568173 TCAGGGGCCTCCTTTCATGGAGG - Intronic
948794029 2:240393011-240393033 TCCAAGGCCTCCTTTCAAAGTGG - Intergenic
948828096 2:240583864-240583886 TCGGGGCCCTCACTTCAAGGAGG - Intergenic
1169415812 20:5415243-5415265 TCTGGGGCCATCCTCCCAAGGGG - Intergenic
1171453402 20:25252193-25252215 GCTGAGGCCTACCTTCCAAGTGG - Intronic
1176367541 21:6043086-6043108 CCTGGGTTCTCCCTCCAAAGGGG - Intergenic
1178380233 21:32101475-32101497 CCTGGGGCCTCATTTTAAAGGGG - Intergenic
1179755978 21:43495456-43495478 CCTGGGTTCTCCCTCCAAAGGGG + Intergenic
1179799034 21:43802317-43802339 TCTGCCGCCTCCCTTCAAGCAGG - Exonic
1183227472 22:36560352-36560374 TCAGGGGGCTCCCTGCAGAGGGG - Intergenic
949681548 3:6519999-6520021 CCTGGGCCCTCCCCTTAAAGTGG + Intergenic
949943402 3:9171934-9171956 TCTGGGGGCTGCCTGCAATGTGG + Intronic
951047794 3:18060663-18060685 TCTTATGCCTTCCTTCAAAGAGG + Intronic
954412424 3:50376621-50376643 CCTGGGGCTTCCCTTCCAGGTGG + Intronic
954644195 3:52120958-52120980 TCAGGGCCCTCCCTTGAAATGGG + Intronic
956466756 3:69527308-69527330 TCTGGGTGTTCTCTTCAAAGGGG - Intronic
956934011 3:74079149-74079171 TCTGGGGCCTCTTTTACAAGGGG - Intergenic
961735790 3:129001553-129001575 TCTGGGGCCGCCCCTGGAAGTGG + Intronic
962516423 3:136156275-136156297 TCTGGTTCCTCCCCTTAAAGAGG - Intronic
962973754 3:140428424-140428446 TCCGGTGGCTCTCTTCAAAGGGG - Intronic
964620029 3:158712019-158712041 TCTGGGGAATTCCTTAAAAGGGG - Intronic
971090056 4:23332153-23332175 TCTGGGGCTTACCTTGAAATGGG + Intergenic
971395358 4:26222038-26222060 TCTAGGGCCCCTCGTCAAAGTGG - Intronic
971977333 4:33707615-33707637 TCTGAGGCTTCCCCTCAAGGAGG - Intergenic
973868182 4:55135909-55135931 CCTGGGGCCTCTTTTTAAAGAGG - Intergenic
976778367 4:88731227-88731249 TCTGTGGAATGCCTTCAAAGGGG - Intronic
977269496 4:94898600-94898622 TCTGAGGCCTCCCAGCAATGTGG + Intronic
980206709 4:129729096-129729118 TCTGGGGCCTCTTTTCATAAGGG - Intergenic
980478752 4:133357152-133357174 TCTGTGGCCTCCCAGCCAAGTGG - Intergenic
981318742 4:143367468-143367490 TCTGGGGCTTTCCTGCAAAGAGG - Intronic
983642347 4:169954779-169954801 ACTGGGGCCTCTCACCAAAGTGG - Intergenic
984550611 4:181154543-181154565 TGTTGGCCCTCCCTTCAAAATGG + Intergenic
984561517 4:181276382-181276404 TCTGGGGCCTCTTTTATAAGGGG + Intergenic
984623575 4:181980057-181980079 TCTGGGGCCTGCAGGCAAAGTGG - Intergenic
985545402 5:506485-506507 TGTGGGGCCACCCTGCCAAGCGG + Intronic
985874032 5:2581755-2581777 TCTTGGGCCTTCCTTCCAGGAGG + Intergenic
985998462 5:3611274-3611296 ACTGGGGGCTTCCTTCAATGTGG - Intergenic
991036661 5:62134436-62134458 TCTGGGGCCTCTTTTATAAGGGG + Intergenic
993903696 5:93601484-93601506 TCTTGGGCCACCCTCCAAAAGGG + Intergenic
998804262 5:145903377-145903399 TCTGGGGCCACCCTGCTAAGAGG + Intergenic
1001206013 5:169763802-169763824 TTTGGGGACCCCTTTCAAAGAGG + Intronic
1001756862 5:174177030-174177052 TCTGGAGCCTCTTTTCAAAAAGG + Intronic
1002098830 5:176847366-176847388 TCCAGGGCCTCCCTTCTATGGGG + Intronic
1003199112 6:3942518-3942540 TCTGGCTCCTCCCTTTAAAAAGG - Intergenic
1003279837 6:4681605-4681627 TCTTGGGCCTACCTGGAAAGTGG - Intergenic
1004217085 6:13712318-13712340 TTTGCCGCCTCCCTCCAAAGAGG + Intergenic
1005067903 6:21836408-21836430 TCTGGGGACTGACTTCATAGGGG + Intergenic
1006418949 6:33921595-33921617 CCTGAGGCCTCCCTTCCAAATGG - Intergenic
1015822473 6:137279374-137279396 TCTGAGGCCTCCCCACAATGTGG - Intergenic
1021950870 7:25773562-25773584 TCTGGGGCCTCTTTTAAAAAGGG - Intergenic
1022646140 7:32230157-32230179 GCTGAGTCCTCCCTTCAAGGTGG - Intronic
1022659039 7:32349048-32349070 AATGGGCCATCCCTTCAAAGCGG + Intergenic
1023523880 7:41078371-41078393 TCTCAGGCCTCCCTTCCCAGGGG - Intergenic
1029287830 7:99478435-99478457 TCTGGTGCCTGCCTGCAGAGGGG + Intronic
1032124731 7:129185001-129185023 TGTGGGCCCTCCAGTCAAAGAGG - Intergenic
1033731991 7:144189129-144189151 TCTGTGGTCTTCCTTCAAGGTGG - Intronic
1033742840 7:144287712-144287734 TCTGTGGTCTTCCTTCAAGGTGG - Intergenic
1033751062 7:144361902-144361924 TCTGTGGTCTTCCTTCAAGGTGG + Intronic
1034304408 7:150038091-150038113 TCTTGGGACTCCCATCACAGGGG - Intergenic
1034453955 7:151154748-151154770 CATGGGGCCTTCCTTCTAAGAGG + Intronic
1034802218 7:154061599-154061621 TCTTGGGACTCCCATCACAGGGG + Intronic
1037793766 8:21973258-21973280 TGTGGGGCCAAGCTTCAAAGGGG - Intronic
1038498550 8:28024584-28024606 TCTGAAGTGTCCCTTCAAAGGGG - Intronic
1041336869 8:56795102-56795124 TCTGATGCCTCCCTTCCCAGAGG + Intergenic
1043125909 8:76394464-76394486 TCTCTGGTCTCCCTTCACAGAGG - Intergenic
1043305436 8:78787736-78787758 TCCACGGCCTCTCTTCAAAGTGG + Intronic
1044347003 8:91116989-91117011 TCTGTGGCCTGCCTTAAAATAGG - Intronic
1049522949 8:143103899-143103921 TTTAGGGCCACCCTTCAAAGGGG + Intergenic
1050231090 9:3526398-3526420 GCGGGGGCCGCTCTTCAAAGTGG - Intergenic
1052757307 9:32554236-32554258 TCTGGGGCCTCCATTTATTGGGG - Intronic
1056924505 9:90821374-90821396 TCTGGGGCCTCCCAGCCATGTGG - Intronic
1058621635 9:106889241-106889263 TCTGAGGCCTCCCTTTTAAAAGG - Intronic
1059168065 9:112097805-112097827 TCTGCTGCTTTCCTTCAAAGGGG + Intronic
1059593670 9:115692717-115692739 TCTAAGGCCTCTCTTCTAAGAGG - Intergenic
1059632884 9:116143370-116143392 ATTGGGACCTCCCTGCAAAGGGG - Intergenic
1059672671 9:116506458-116506480 TCTGGGGCTTCCCGCCTAAGAGG - Intronic
1060155127 9:121314125-121314147 GCTGAGGCCCCCCTCCAAAGGGG - Intronic
1060760103 9:126239811-126239833 CCTGGGGTCTGGCTTCAAAGAGG - Intergenic
1060908072 9:127325936-127325958 TCTGGGGCTTCCCTTTGAACAGG - Intronic
1062176403 9:135165584-135165606 TCTGGTGCCTCCGTTAGAAGAGG + Intergenic
1186006795 X:5080984-5081006 TAGGGAGACTCCCTTCAAAGAGG + Intergenic
1187119323 X:16388027-16388049 TCAGAGTCCTCCCTTCTAAGGGG - Intergenic
1191063033 X:56319081-56319103 TCTGGGGCCTCACTCCATAGGGG - Intergenic
1198804939 X:140484931-140484953 TCTGGGGCTTCCTTTCCGAGAGG - Intergenic
1200127914 X:153825535-153825557 TCTGGGACCTCCCCTGAAAATGG - Intronic