ID: 1133466941

View in Genome Browser
Species Human (GRCh38)
Location 16:6036406-6036428
Sequence TGCCATTGCTTTTTTGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 313
Summary {0: 1, 1: 0, 2: 3, 3: 29, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133466935_1133466941 13 Left 1133466935 16:6036370-6036392 CCATCCATTCTAGCATAATGTTT 0: 1
1: 0
2: 3
3: 12
4: 217
Right 1133466941 16:6036406-6036428 TGCCATTGCTTTTTTGGGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 280
1133466936_1133466941 9 Left 1133466936 16:6036374-6036396 CCATTCTAGCATAATGTTTTGTG 0: 1
1: 0
2: 0
3: 18
4: 247
Right 1133466941 16:6036406-6036428 TGCCATTGCTTTTTTGGGGAGGG 0: 1
1: 0
2: 3
3: 29
4: 280

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133466941 Original CRISPR TGCCATTGCTTTTTTGGGGA GGG Intronic
900304814 1:2000368-2000390 GGACATGGGTTTTTTGGGGAAGG + Intronic
901471532 1:9460025-9460047 TGCCACTGCTGCTTTGAGGATGG - Intergenic
903757199 1:25670879-25670901 TGCCACTACTTTTTTTGAGATGG + Intronic
906633624 1:47392977-47392999 TGGCATTGCTTTTTTGAGGGGGG - Intergenic
907340170 1:53729495-53729517 TAACAATGCTTTTTGGGGGAGGG - Intronic
907491492 1:54811688-54811710 TCCCATTCCCTTCTTGGGGATGG + Intronic
908110381 1:60891193-60891215 TGCCACTCTTTATTTGGGGAGGG - Intronic
910290952 1:85599915-85599937 AGCCACTGCTTTTTTGGGTGAGG + Intergenic
911529775 1:99030837-99030859 TCACATTGCTTTTTTGGGGTGGG + Intergenic
912649844 1:111427920-111427942 TGCTGTTGCTTTGTTGGAGAGGG - Intergenic
912915105 1:113807004-113807026 TGTTTTTGTTTTTTTGGGGAGGG - Intronic
912924710 1:113904046-113904068 TGCAATTGCTTTATTGATGAAGG + Intronic
914226075 1:145720709-145720731 TGCCAGAGGTTTTCTGGGGAGGG - Intronic
914287716 1:146242481-146242503 TGCCATAGCTTTATTAGAGAAGG - Intergenic
916880562 1:169016244-169016266 GTCCATTGCTTTTTGGGAGAGGG - Intergenic
917975072 1:180233135-180233157 TTCCTTTGCTTATTTGGGGATGG + Intronic
918708557 1:187699119-187699141 TCCCATTGATTTTCTGGGAATGG + Intergenic
919725857 1:200883032-200883054 TTCCATTTCTTTTTTGGTGTGGG - Intergenic
919865618 1:201780711-201780733 AGCCTTAGCTTTTTTTGGGAGGG - Intronic
920131183 1:203733054-203733076 CACCATTGCTTTTTGTGGGAGGG + Intronic
921601238 1:217109057-217109079 TCCCATTACATTTTTGTGGATGG - Intronic
921742895 1:218706811-218706833 TTCCATGGCTTATTTGTGGACGG - Intergenic
922637879 1:227194279-227194301 TTTCATTGTTTTTTTGGGGGAGG - Intronic
923021033 1:230164010-230164032 TGACTTTGTTTTTTTTGGGAGGG + Intronic
923892942 1:238235796-238235818 TGCCATTGCTTGTCTGAAGATGG + Intergenic
1063045199 10:2384665-2384687 TGCCATTGATTTGTTGTGGCCGG - Intergenic
1063450243 10:6145727-6145749 TGAGTTTGCTTTTCTGGGGACGG - Intronic
1063889146 10:10611607-10611629 TGACATTGACTTTTTGGGGAAGG - Intergenic
1064019650 10:11798905-11798927 TGCCATTCCTTCTTTGGGCCTGG - Intergenic
1064470635 10:15631791-15631813 AGCCATGGCTTTTTTTGGGGGGG - Intronic
1064509635 10:16075678-16075700 TGCCATTGCTTTTGAAGTGAAGG + Intergenic
1065476476 10:26143324-26143346 TGACCTTGCTTTTTTTGTGACGG - Intronic
1065582023 10:27181609-27181631 TACCATTGATTTTTTGCAGATGG + Intronic
1066955142 10:42160712-42160734 TTCCATTGCCTTTATGTGGAAGG + Intergenic
1068574525 10:58670281-58670303 TTACATAGCTTTTTTGGGGGTGG + Intronic
1068745133 10:60521793-60521815 TGTCATTGCTTTTTTGGGGTAGG - Intronic
1069716999 10:70527592-70527614 TGCCATTCCTTTTCTGGAAAGGG - Intronic
1070964787 10:80523239-80523261 TGCCATTGCACTTCTGTGGATGG + Exonic
1071702029 10:87949432-87949454 TGCCTATCCTTTTTTGGGTAAGG + Intronic
1073317745 10:102594720-102594742 TGCCTTTTCTTTTTTTGAGACGG + Intronic
1073469889 10:103716007-103716029 TCCCATTTATATTTTGGGGATGG - Intronic
1073497235 10:103903895-103903917 TGGCATTGCTTTGGTGAGGAAGG - Intronic
1073617108 10:105007096-105007118 TTCCTTTTCTTCTTTGGGGAAGG - Intronic
1074437787 10:113449032-113449054 TGCCAGTGTGTTTTTGGGAAGGG - Intergenic
1074458761 10:113617952-113617974 TGTCAGTGTTTTTTTGTGGAAGG - Intronic
1074540574 10:114362257-114362279 AGACATATCTTTTTTGGGGAGGG - Intronic
1074796609 10:116952176-116952198 ATCCATGGCTATTTTGGGGAGGG - Intronic
1077375092 11:2202058-2202080 AGACATTGCATTTTTGGGCAGGG - Intergenic
1077451146 11:2646511-2646533 TGCTACTGATTTTTTGGGGGAGG + Intronic
1079528107 11:21414968-21414990 TGCTTATGCTTTTTTTGGGAGGG - Intronic
1079973585 11:27065057-27065079 GGCCATTGAGTTCTTGGGGAAGG + Intronic
1080808011 11:35673729-35673751 GGCAATTGATTTTTTGGGTAAGG + Intronic
1081517171 11:43844182-43844204 TCAGATTGCTCTTTTGGGGAAGG + Intronic
1081591760 11:44427960-44427982 TGCCATCGCCATATTGGGGAAGG - Intergenic
1083803210 11:65058420-65058442 TGAGTTGGCTTTTTTGGGGATGG + Exonic
1086862537 11:91941963-91941985 TGCCATTGCTATTCTCGGAATGG + Intergenic
1087147771 11:94828792-94828814 TGCCATTGCTGTCTTATGGAAGG + Intronic
1088445276 11:109919946-109919968 TGCCTTTGCTTTTTTGTCAAAGG + Intergenic
1088671145 11:112142085-112142107 TACCATTTTTTTTTTGGAGACGG + Intronic
1089845428 11:121454382-121454404 TGCCATTTCTTTCTTGGGTTTGG + Intronic
1090649280 11:128792209-128792231 TGCCATTGCCTAGGTGGGGAGGG - Intronic
1091359498 11:134964600-134964622 TTCCATTGCTTTTATGGAGGAGG - Intergenic
1091911895 12:4239715-4239737 TGAATTTGCTTTTTTGGGGAAGG + Intergenic
1092656636 12:10691964-10691986 TGCCATTGTCTTTTTGTGGATGG - Intergenic
1092745764 12:11670999-11671021 TCCCATCACTTTTTTGGGGCAGG - Intronic
1093285572 12:17256458-17256480 TACCCTAGCTTTTTGGGGGAAGG + Intergenic
1093545874 12:20346992-20347014 TGCCATTGCTGGTTTGAAGATGG - Intergenic
1095461694 12:42450856-42450878 TGCTATTGCTACTTTTGGGAGGG - Intronic
1095840645 12:46687941-46687963 GGCCATTGTTTTTTGGGGGGGGG - Intergenic
1096578996 12:52572364-52572386 TGCCATTATTTTTTAGGAGATGG - Intronic
1098362634 12:69669699-69669721 TCCCAATGATCTTTTGGGGAAGG + Intronic
1099844453 12:88012071-88012093 TCCCATTTGTTTTTTGGGGTAGG + Intronic
1100054628 12:90493758-90493780 TGCCTTTTCTTTTTTCTGGAGGG + Intergenic
1100330377 12:93575988-93576010 TGCCATTGATTTTTTGGAAATGG + Exonic
1100392643 12:94157353-94157375 TGCCAATGCATGTTTGGGGAAGG - Intronic
1101644443 12:106616763-106616785 TGCCTTTACTTTTTTTGAGACGG + Intronic
1103098361 12:118150384-118150406 TATTATTACTTTTTTGGGGACGG - Exonic
1104127655 12:125862850-125862872 TTCCTTTACTTTTTTGGTGAGGG - Intergenic
1106291736 13:28369518-28369540 TTCCTTTTCTTTTTTGGAGATGG - Intronic
1106310158 13:28547175-28547197 TGCCATAGCTACTATGGGGAAGG + Intergenic
1108983724 13:56556169-56556191 TGCCAGGGTTTTTTTGGGGGCGG + Intergenic
1109417784 13:62066044-62066066 CGCTATTCCTTTTTTGGGGGGGG + Intergenic
1109625032 13:64963055-64963077 AGCTATTGCTTTCTTGGGGCAGG - Intergenic
1109989922 13:70041380-70041402 AGACATTGCTTTTTGGGTGAAGG + Intronic
1110361570 13:74631113-74631135 TGCCATGGCATTAGTGGGGAGGG + Intergenic
1110639706 13:77808573-77808595 TTCTATTGCTTTTTTGAGAAGGG + Intergenic
1111200675 13:84932202-84932224 TGACATTACTGTTTTTGGGAGGG + Intergenic
1113538637 13:111088480-111088502 TGACAGAGCTTTTTTGGGGACGG + Intergenic
1113556002 13:111235080-111235102 AGACACTGCTTTTTTGGGGAAGG + Intronic
1113611857 13:111652279-111652301 TGTTTTTGTTTTTTTGGGGATGG - Intronic
1116761589 14:49021963-49021985 TGCCATTGCTGTCTTGGGGTCGG - Intergenic
1119140854 14:72265924-72265946 TCCTATCGCTTTTTTGGGGGGGG + Intronic
1120196727 14:81492479-81492501 TGCCATGGCCTTTTTGGGAAAGG - Exonic
1120209558 14:81621562-81621584 TGCCCTTGCCTTTTTGGCGAAGG + Intergenic
1120464348 14:84837458-84837480 TGCCAGTGCTTTTCAGGAGACGG + Intergenic
1120689875 14:87580680-87580702 TGCCATTGCTCCTTTGAAGATGG + Intergenic
1120739374 14:88090975-88090997 TGCTACTGCTTCTTTAGGGATGG - Intergenic
1121143386 14:91561753-91561775 TCCCATTGCTTTTTTTGGTCAGG - Intergenic
1121266660 14:92607602-92607624 TTCCCATCCTTTTTTGGGGAAGG - Intronic
1123129382 14:105973377-105973399 TGTCATTGCTTATGAGGGGAGGG + Intergenic
1123409896 15:20049543-20049565 TGTCATTGCTTATGAGGGGAGGG + Intergenic
1123437048 15:20262230-20262252 TTCCTTTTTTTTTTTGGGGACGG + Intergenic
1123519228 15:21056251-21056273 TGTCATTGCTTATGAGGGGAGGG + Intergenic
1124339032 15:28877934-28877956 TGCCATTTTTTTTTTTGAGATGG - Intergenic
1126095218 15:45083664-45083686 TTCCTTTTCTTTTTTGGAGATGG + Intergenic
1126112483 15:45183864-45183886 TGCCGTTGCTGCTTTGAGGATGG - Intronic
1126222840 15:46234748-46234770 TGCCACTGCTTTTTTTGCGAAGG + Intergenic
1126554930 15:49976069-49976091 CGCCATACCTCTTTTGGGGAGGG - Intronic
1127133714 15:55896976-55896998 TGACATGGCTTTTTTTGAGATGG + Intronic
1131073440 15:89480093-89480115 TGCCAGTTCTTTTTGGGGGAAGG - Intronic
1131591283 15:93751533-93751555 TGCCATTGCTTTTTTTGGTCAGG - Intergenic
1132660030 16:1057264-1057286 GGCCAATCCTTCTTTGGGGATGG - Intergenic
1133075226 16:3275003-3275025 TGCCATTGATTAGTTGTGGAAGG - Intronic
1133466941 16:6036406-6036428 TGCCATTGCTTTTTTGGGGAGGG + Intronic
1137398027 16:48130818-48130840 AGCCATTGCTTTGATGGAGAAGG + Exonic
1140859095 16:79003804-79003826 TTCCACTGCATCTTTGGGGAAGG + Intronic
1143809584 17:9460308-9460330 TCCCATTCCTTTCTGGGGGAAGG + Intronic
1144023554 17:11258183-11258205 TGCCCTTTCTCTTTTCGGGATGG - Intronic
1144067036 17:11633947-11633969 TGCCATTGCTTTTCTTCTGATGG + Intronic
1146491992 17:33290271-33290293 TGACAAAGCTTTTTTTGGGATGG - Intronic
1147926405 17:43948862-43948884 TGCCATTCCGTTTTTAGGAATGG + Intergenic
1148112126 17:45150706-45150728 TGTGACTGCATTTTTGGGGAGGG + Exonic
1148240334 17:45996170-45996192 TTCCATTGCTTTCCTGGGAAAGG + Intronic
1148636648 17:49154008-49154030 TGCTTTTTTTTTTTTGGGGACGG + Intronic
1149127920 17:53257765-53257787 GGCCCTGGCTTTTTTGGGGGTGG - Intergenic
1149548902 17:57525258-57525280 TTACTTTGCTTTTTTGGGGGGGG + Intronic
1149561307 17:57609681-57609703 TGCCCTGGCATCTTTGGGGATGG - Intronic
1150203307 17:63379289-63379311 TTCAACTGGTTTTTTGGGGAAGG - Intronic
1152079955 17:78180778-78180800 TGCCTTTTCATTTCTGGGGAAGG - Intronic
1152352834 17:79792967-79792989 TCCCATTGCTTGTTGAGGGAGGG - Exonic
1152401210 17:80067337-80067359 TGCCTTTGCTTGTCTTGGGAGGG - Intronic
1153455791 18:5280723-5280745 TTTCTTTTCTTTTTTGGGGAGGG + Intergenic
1155143371 18:23063541-23063563 TGCCAGTCCTTTTCTGAGGAAGG - Intergenic
1155453110 18:25983627-25983649 TGGCTTTGTTGTTTTGGGGAGGG - Intergenic
1155685006 18:28537899-28537921 TGGCAATGCTAGTTTGGGGAGGG - Intergenic
1156258124 18:35418709-35418731 TACCATTGCTTGTTTGAAGATGG - Intergenic
1156436947 18:37142194-37142216 TGTTTTTGTTTTTTTGGGGATGG + Intronic
1157179118 18:45479982-45480004 TGCAAATCCTTTCTTGGGGAAGG - Intronic
1157489437 18:48112349-48112371 TACCATTTCTTTTTTTGAGATGG + Intronic
1158083559 18:53623506-53623528 TGCCATTGACTTTTTGGAAAGGG + Intergenic
1158602293 18:58864783-58864805 TGCCATAGCTTTTTTATGTAGGG + Intronic
1158952749 18:62510575-62510597 TATCATTGCTTTTTGGGGAAAGG - Intergenic
1160493206 18:79354959-79354981 TCCACTTGCCTTTTTGGGGAGGG - Intronic
1164146236 19:22514297-22514319 GGCCAGGGCTTCTTTGGGGAGGG - Intronic
1164160123 19:22620767-22620789 GGCCAGGGCTTCTTTGGGGAGGG + Intergenic
1165060768 19:33204268-33204290 GGCCACTGCCCTTTTGGGGAGGG + Intronic
1166378159 19:42340051-42340073 TGTTTTTGTTTTTTTGGGGACGG - Intronic
1168697351 19:58411647-58411669 TGCCTTTTCTTTTTTTGAGACGG + Intronic
925521058 2:4746383-4746405 TGTCAATGCTTGTTTGGGGTGGG + Intergenic
926374489 2:12212954-12212976 TGCCATTGTTATTTTGCAGAGGG + Intergenic
926661407 2:15471092-15471114 AGCAAGTACTTTTTTGGGGAGGG - Intronic
927231921 2:20832484-20832506 TGCCAGTGCCATTTTGTGGAGGG - Intergenic
927987138 2:27419947-27419969 TGCCTTTTCTTTTTTTGAGACGG + Intergenic
928039600 2:27861650-27861672 TTCCATTTCTTTTTGGGGGGGGG + Intronic
931574974 2:63709308-63709330 TTCCATTCTTTTTTTCGGGACGG - Intronic
934125204 2:88881775-88881797 CTCCACTGCATTTTTGGGGATGG + Intergenic
934886104 2:98026712-98026734 GGCAATGGCTTTTTTGGTGAGGG + Intergenic
936754587 2:115691377-115691399 TGAAATTGCTTTTTTTGGTATGG + Intronic
938748975 2:134310613-134310635 CTCAATTGCTTTGTTGGGGAGGG + Intronic
938783457 2:134605681-134605703 TGCCTTTCCTTTTTTTGAGATGG - Intronic
942920400 2:181366160-181366182 TGCGATTGATCATTTGGGGATGG - Intergenic
944416116 2:199481462-199481484 TGCCATAGCTATTTTGCGGGAGG - Intergenic
944922795 2:204433230-204433252 TGACAAAGCTTTTCTGGGGATGG + Intergenic
945616985 2:212083637-212083659 TGGCATTGTTTTTTTTGGGGGGG - Intronic
947322598 2:228938604-228938626 TCACATCCCTTTTTTGGGGAAGG - Intronic
947754677 2:232553139-232553161 TGTAATTGCTTTTGTGGAGAAGG + Intronic
948181280 2:235982976-235982998 TGCAAATGCTTTTTAGGGGTTGG - Intronic
948381828 2:237555900-237555922 TACTATTACTCTTTTGGGGATGG - Intergenic
948676017 2:239597208-239597230 TGGCCTTGCTTCTTTGGGAAAGG - Intergenic
1168811567 20:708026-708048 TGCCATTGTCTGTTTGGGGCTGG + Intergenic
1169956034 20:11103864-11103886 AGCCAATTCTTTTTTGTGGATGG - Intergenic
1171055679 20:21904086-21904108 GGCCAATCCTTTTTGGGGGAGGG + Intergenic
1171888868 20:30688468-30688490 TGCGATTTTTTTTTTGGGGGGGG + Intergenic
1172209876 20:33189745-33189767 TGCCATTGATTTTTTGGAAATGG + Intergenic
1173506128 20:43588767-43588789 TACTCTTGCTTTTTTGGGGGGGG + Intergenic
1173983761 20:47245062-47245084 TGTATTGGCTTTTTTGGGGAGGG - Intronic
1174463833 20:50702021-50702043 TGCCTTTTTTTTTTTGGAGACGG + Intergenic
1174536445 20:51255001-51255023 GGAAATTGCTTTTTTGGGGAGGG - Intergenic
1174755068 20:53150113-53150135 CGCTATTTCTGTTTTGGGGATGG + Intronic
1175542555 20:59756820-59756842 TGCCATTGCTTGGTGGGGGGAGG - Intronic
1175706678 20:61183970-61183992 TGTCATTTCTTTTCTAGGGAAGG + Intergenic
1176366481 21:6035996-6036018 TGCCATGGCCTGTTGGGGGAGGG + Intergenic
1178202792 21:30426834-30426856 TAACACTGCATTTTTGGGGAAGG + Intergenic
1179757036 21:43502549-43502571 TGCCATGGCCTGTTGGGGGAGGG - Intergenic
1181823673 22:25495601-25495623 AGCCATTGATTTTTTGGGGGTGG + Intergenic
1185081533 22:48712058-48712080 GATCACTGCTTTTTTGGGGATGG + Intronic
950536162 3:13580038-13580060 TGCCATTGCGTGTATCGGGAGGG + Intronic
950587088 3:13900983-13901005 TCCCATTGCTTTTATGGAGTAGG + Intergenic
951033879 3:17911677-17911699 TGCCATTTTTTTCTTTGGGAGGG - Intronic
951111279 3:18807308-18807330 AGTCATTGCTTCTTTGGGTATGG + Intergenic
952424155 3:33157915-33157937 TGCCACTAAGTTTTTGGGGATGG + Intronic
953783711 3:45894595-45894617 TGCCATTCCTCATTTGTGGATGG + Intronic
953963863 3:47286957-47286979 TGCAGTTGCTTGTCTGGGGAGGG + Intronic
954575652 3:51674607-51674629 GGCCAGGGCTTCTTTGGGGAGGG + Intronic
954925151 3:54227544-54227566 GTCCATGGCTTTTTTGGGGAGGG + Intronic
956757960 3:72408326-72408348 TACCATTGCTTTAATGGTGATGG - Intronic
958027382 3:88064453-88064475 TGCCATTGTTTTGTTAGGGGAGG + Intronic
959077607 3:101765606-101765628 TGCCTTTGCTTTTTTTTGGAGGG + Exonic
959717857 3:109453088-109453110 CTCCACTGCATTTTTGGGGATGG + Intergenic
959793644 3:110395346-110395368 TGCCACTGCTTTTTTAGCCAAGG + Intergenic
959829060 3:110838402-110838424 TCCCATTCCATTTTTGGGAAAGG - Intergenic
959896423 3:111611814-111611836 TGACATTGCTTGTTGGGAGAGGG + Intronic
960129887 3:114044617-114044639 TGCCATTGGCTTTCAGGGGAAGG + Intronic
962225797 3:133606739-133606761 TGCCAAAGCTTTTGTGGGAAAGG + Intronic
962305367 3:134281397-134281419 TGCCAATGTTATTCTGGGGATGG + Intergenic
963102283 3:141619085-141619107 TGTCATGGAGTTTTTGGGGAAGG - Intergenic
963275867 3:143329479-143329501 TCCCATTGAGTTCTTGGGGAGGG + Intronic
964213951 3:154258533-154258555 TGCCATTGCTGCTTTGAAGATGG - Intergenic
964438924 3:156684028-156684050 TGCAATTGTCTTTTTGTGGAAGG + Intronic
965495990 3:169399950-169399972 AGACATTCCTTTTTTGGGTAAGG - Intronic
967832453 3:193932003-193932025 TGGCATGGCAGTTTTGGGGAAGG - Intergenic
968240816 3:197083522-197083544 TGTCTCTGCTTTTGTGGGGAAGG - Intronic
969030824 4:4211979-4212001 TGCCTTTCTTTTTTTGGGTATGG - Intronic
970554859 4:17220884-17220906 TTCCAGTGGTGTTTTGGGGAAGG - Intergenic
971841882 4:31862786-31862808 TGTCACTTCTTCTTTGGGGATGG + Intergenic
972712219 4:41608966-41608988 TTCCCTTGCTTTTCTGGGCAAGG - Intronic
973329496 4:48897702-48897724 TGACATTTATTTTTTGGTGAAGG - Intronic
973654760 4:53035200-53035222 TGCCATTGCTTTTTTGTGTCAGG - Intronic
974077242 4:57178424-57178446 TGCCATACCTGCTTTGGGGAAGG - Intergenic
974920776 4:68236648-68236670 GGGCATTGCTGTTTTGAGGAGGG - Intronic
976625129 4:87172185-87172207 TGCCATTGCTTGTTTGAAGGTGG + Intronic
977698127 4:99990286-99990308 TGTCTTTGCTTTTTTTGAGATGG + Intergenic
977724407 4:100278369-100278391 TGTCATTGCTATTTTGGATAGGG + Intergenic
978422451 4:108547116-108547138 TGAAATTGCTTTCTTAGGGAAGG - Intergenic
979646348 4:123074937-123074959 TTCCATCTCTTTTTTGGGGGCGG + Intronic
981145232 4:141316187-141316209 TGCCATTGCTTTTCAGCAGATGG + Intergenic
982744598 4:159093866-159093888 TGCAATTTCTTTTTGGGAGAAGG + Intergenic
983032644 4:162822138-162822160 TTCCATTTCTTTTGTTGGGATGG - Intergenic
983504755 4:168540935-168540957 TCTCATTGCATTTTTGTGGAAGG + Intronic
985882280 5:2647360-2647382 TGCCACAGCTTTTTTGTAGATGG + Intergenic
988524631 5:31976370-31976392 TCCCATTACTTCTTAGGGGAGGG + Intronic
989111077 5:37907061-37907083 TCCCCCTGCTTTGTTGGGGAGGG + Intergenic
992100764 5:73405299-73405321 TGCTATTGCTTCTGTGGGTATGG + Intergenic
994198244 5:96943290-96943312 TGCTGTTCCTTTTTTTGGGAGGG + Intronic
994208955 5:97066667-97066689 TTCAAGTGCTTTTTTGGAGACGG - Intergenic
995695223 5:114871617-114871639 CCCCATTGCTTTTTTTGGTAAGG - Intergenic
998201603 5:140128829-140128851 TTTCAGTGCTTTTTGGGGGAAGG + Exonic
998992457 5:147832914-147832936 TTCCATTGCCTTTTTGTTGAGGG + Intergenic
999014440 5:148084566-148084588 TGCTGTTGATTTTCTGGGGAAGG + Intronic
999110380 5:149115370-149115392 TGCCATTGCATTGTTGTGGGTGG - Intergenic
999879639 5:155847579-155847601 TGCCAGTCCTTTTTAGGGCAAGG - Intergenic
999980862 5:156956708-156956730 TTCAATAGCATTTTTGGGGAAGG - Intronic
1000390656 5:160719393-160719415 TGCCATTACTTTTTTTGAGACGG - Intronic
1000531761 5:162430611-162430633 TGCAATTGCTGTTTTGGGGAGGG + Intergenic
1001326275 5:170727933-170727955 TTTTATTGCTTTTTTGAGGAAGG - Intronic
1001849929 5:174954813-174954835 TTCCAGTGATTTTTTGGGGGAGG - Intergenic
1001913329 5:175539141-175539163 TGCCATTTCTTCTTTCTGGAAGG + Intergenic
1002847607 6:961802-961824 TGGCATGGTTTATTTGGGGAGGG + Intergenic
1005650702 6:27882299-27882321 TGGCTTTGGTTTTTTGGAGACGG + Intergenic
1006205678 6:32340338-32340360 TTACTTTGCTGTTTTGGGGAGGG + Intronic
1007346965 6:41238103-41238125 TTCTTTTGCTCTTTTGGGGATGG + Exonic
1007496449 6:42263198-42263220 TCCCTTTGCTTTCTTGGAGATGG - Intronic
1008187766 6:48415194-48415216 TGCCTCTGCTTTGTTTGGGAGGG + Intergenic
1011028041 6:82890880-82890902 GGCCATTGCTTTTTTCCAGAGGG + Intergenic
1012762878 6:103324271-103324293 TGCCATTGCTTGTTTGGCTCTGG - Intergenic
1015625119 6:135173724-135173746 TGCCAATGGTTTTTTGGGGGAGG + Intergenic
1019403516 7:869658-869680 TTCCAGTGCTTTTCTAGGGAGGG + Intronic
1019885594 7:3901826-3901848 TTCCATTCCTTTTTTTAGGAAGG + Intronic
1021065905 7:16172072-16172094 TCACATTGCTTGTTTGAGGAAGG - Intronic
1021477945 7:21084140-21084162 TGCCATTGCTCTCTTGGGAGGGG - Intergenic
1022231509 7:28418067-28418089 TGCCTTTAGTTGTTTGGGGAGGG + Intronic
1023452513 7:40302971-40302993 TGGGATTGTTTGTTTGGGGAAGG - Intronic
1026592288 7:71707396-71707418 TGCCTTTACTTTCCTGGGGAAGG - Intronic
1026593708 7:71716824-71716846 TGCCAATGCTTTTCTGGGAAGGG + Intergenic
1030418294 7:109273015-109273037 TACCTTTGCTTGATTGGGGAAGG - Intergenic
1030657845 7:112187563-112187585 TGCCATTTCTTTTTTGGGTTTGG - Intronic
1033676484 7:143545149-143545171 TGTCATTGCTTTTTTTAGGGGGG - Intergenic
1033695349 7:143784290-143784312 TGTCATTGCTTTTTTTAGGGGGG + Intergenic
1035164498 7:156977758-156977780 TGACATTCCTTTTTTTGAGATGG + Intergenic
1035468925 7:159097490-159097512 TGCCATTGCTTCTGTGGTGGAGG - Intronic
1036998964 8:13695168-13695190 TGCCATGGCTTTACTGTGGAGGG + Intergenic
1037014574 8:13886523-13886545 TGCCACTGCTTTTGGGGGAAGGG - Intergenic
1038084935 8:24185626-24185648 AGCCATTGAGTTTTTGGTGAAGG + Intergenic
1038331221 8:26611046-26611068 TGCCATTTCTATTTTGCAGATGG + Intronic
1039441603 8:37598901-37598923 TGCCCTTGCTTTCTGGGGAAAGG + Intergenic
1040859719 8:51986514-51986536 TGCCATTTCTATTTTATGGAGGG + Intergenic
1041248995 8:55916740-55916762 TGCCATTGCAGTATTGGGCATGG - Intronic
1043384492 8:79734639-79734661 TGCACTTGCTTTTTAGAGGATGG - Intergenic
1044116010 8:88335033-88335055 TGCCAGACCTTTTTTGGGGGGGG + Intergenic
1045121027 8:99034786-99034808 TGTCATTGCTTTTTGGGGAGAGG + Intronic
1045912709 8:107428700-107428722 TGCCAGTGCTTTTTTAAGCAAGG + Intronic
1046005443 8:108476583-108476605 TAGAATAGCTTTTTTGGGGAAGG + Intronic
1047669116 8:127125364-127125386 TGCCTTTGCTTTCATGGGGCTGG + Intergenic
1048784239 8:138033768-138033790 TTCCATTGCTTTATTGGGTTAGG - Intergenic
1050018601 9:1261133-1261155 TGGCATTACATTTTTGGGAATGG + Intergenic
1050468111 9:5954064-5954086 TGTGATTGCTTTTTTAGAGACGG + Exonic
1052974129 9:34399380-34399402 TGCTATTGCTGGTTTGGGGGAGG - Exonic
1061343086 9:129999203-129999225 AGCCTTTGCTACTTTGGGGATGG + Intronic
1061757549 9:132826015-132826037 TGCCCTTGCCTTTTTGGGCAGGG + Intronic
1062311568 9:135940658-135940680 TGCTAATTCGTTTTTGGGGAAGG + Intronic
1062342752 9:136100992-136101014 TGCCATTTCTTTCTTTAGGACGG + Intergenic
1062690429 9:137838649-137838671 TGCAATTGCCTTCTTAGGGAAGG + Intronic
1185891750 X:3828226-3828248 TTCCTTTTCTTTTTTGGAGACGG - Intronic
1186016439 X:5200189-5200211 TGCTTTTGCTTTTTTAGGCAGGG + Intergenic
1186049238 X:5572327-5572349 TGCAATTAATTTTTTGGGCATGG + Intergenic
1187232444 X:17435545-17435567 TGCCCTTGGTGATTTGGGGAGGG + Intronic
1187416483 X:19097504-19097526 TGCCTTTGTTTTTTTTGAGACGG - Intronic
1187844792 X:23524338-23524360 TGCCATTGCTGTTGTGGGGATGG - Intergenic
1187896074 X:23980746-23980768 TGTCATTGCTTTTTAGGGAGAGG + Intergenic
1188020813 X:25155298-25155320 TGTCATTGCTTTTCTGTGGATGG - Intergenic
1188545535 X:31301682-31301704 TACCACTGCATTTTAGGGGAAGG + Intronic
1189337445 X:40178735-40178757 TGCCACCTCTTTTTTGGGGGTGG + Intergenic
1192326234 X:70134450-70134472 GGCCCTTGCTTTCTGGGGGACGG - Intronic
1192481666 X:71491623-71491645 AGCCATTCCTTTTATAGGGATGG - Intronic
1195653925 X:107316091-107316113 TGCATTTGCTTTTTGTGGGAGGG - Intergenic
1195885252 X:109630673-109630695 TGCCATTGCTTTACGGGGGTTGG - Intronic
1196537489 X:116864559-116864581 TTCCATTGCTTGTTTGGATAAGG + Intergenic
1196767282 X:119258721-119258743 TGATATTTCTTCTTTGGGGAAGG - Intergenic
1197528890 X:127598501-127598523 AGCCATTGCTTCTTTGAGGATGG + Intergenic
1198540470 X:137633537-137633559 TGCATTTGTTTTTTTGGGGGAGG + Intergenic
1199972608 X:152872136-152872158 AGGCATGGCTTTTTAGGGGAAGG - Intergenic
1200014646 X:153149236-153149258 TCCCATTTCTTTCTTGGGGTGGG + Intergenic
1200024955 X:153250716-153250738 TCCCATTTCTTTCTTGGGGTGGG - Intergenic