ID: 1133469504

View in Genome Browser
Species Human (GRCh38)
Location 16:6060910-6060932
Sequence TCTTTCCCACATATGGCACA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 171}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133469502_1133469504 -4 Left 1133469502 16:6060891-6060913 CCTTTTCTCTCTGTAGATTTCTT 0: 1
1: 0
2: 5
3: 97
4: 1166
Right 1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG 0: 1
1: 0
2: 0
3: 19
4: 171
1133469500_1133469504 6 Left 1133469500 16:6060881-6060903 CCATTACCTTCCTTTTCTCTCTG 0: 1
1: 1
2: 9
3: 191
4: 1540
Right 1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG 0: 1
1: 0
2: 0
3: 19
4: 171
1133469501_1133469504 0 Left 1133469501 16:6060887-6060909 CCTTCCTTTTCTCTCTGTAGATT 0: 1
1: 1
2: 9
3: 68
4: 697
Right 1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG 0: 1
1: 0
2: 0
3: 19
4: 171
1133469499_1133469504 19 Left 1133469499 16:6060868-6060890 CCTTCTGTCTGTGCCATTACCTT 0: 1
1: 0
2: 1
3: 20
4: 275
Right 1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG 0: 1
1: 0
2: 0
3: 19
4: 171

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133469504 Original CRISPR TCTTTCCCACATATGGCACA TGG Intronic
900820275 1:4881300-4881322 CCTTCCCCATAGATGGCACAGGG + Intergenic
903178119 1:21592471-21592493 TATGTCCCAAATATCGCACAAGG + Intergenic
905203021 1:36326597-36326619 TCTTTCCAAAATGTGTCACAGGG - Intronic
906436188 1:45798629-45798651 TCTGTCACACATATGGCAATTGG - Intronic
908109245 1:60878307-60878329 CCTTTCCCCCATATGGCCCATGG - Intronic
908299399 1:62748006-62748028 TCTTTCCGACAAATGACACTAGG + Intergenic
911564509 1:99447558-99447580 TATTTTCCTCAAATGGCACATGG + Intergenic
911729887 1:101281901-101281923 TGTTCCCCAGATGTGGCACATGG - Intergenic
914463925 1:147909423-147909445 TCTTTCCCACATCCAGCATAAGG + Intergenic
917453488 1:175166506-175166528 TCTTCCCCTCATTTAGCACATGG - Intronic
917514196 1:175693471-175693493 CATTTCCCACATGTGACACAGGG - Intronic
920217461 1:204371115-204371137 TCATTGCCACATGTGGCTCATGG + Intronic
920534275 1:206727558-206727580 TCTCTCCTGCATATGGCACCTGG - Intronic
920549924 1:206850568-206850590 TCTTTTCCTCATGAGGCACATGG + Intergenic
920580298 1:207100418-207100440 TCTTGCCCACATCTGGCTTACGG + Intergenic
921088585 1:211820162-211820184 TCTTTTTCACATATGACACCTGG - Intronic
922691714 1:227697685-227697707 GATTTCTCACATATGGCACATGG + Intergenic
923983675 1:239355136-239355158 TCTTTCCTTCAAATGGCACCTGG - Intergenic
1062926867 10:1322937-1322959 TCTGTACCACATTTGGCACCAGG + Intronic
1067203166 10:44192472-44192494 TCCTTCCCACAGGTGGCACATGG - Intergenic
1067470943 10:46537201-46537223 TCTGTCCCTCACATGGCACTGGG + Intergenic
1069100717 10:64317062-64317084 TCATTGTGACATATGGCACATGG - Intergenic
1071496081 10:86168551-86168573 TCCTTCCCACACCTGGCAGAGGG - Intronic
1072756280 10:98023292-98023314 TCCTTCCCAGAGCTGGCACAAGG - Intronic
1074253441 10:111776945-111776967 CCTTTCCCCCAAATGGCACACGG + Intergenic
1074444037 10:113503717-113503739 TCTTTCCCACCTCTAGCACATGG + Intergenic
1076141467 10:128081934-128081956 TCTTTCCAACACATTGCACTTGG - Intronic
1077810151 11:5628609-5628631 TCTTTCCCACGCTTGGCAAAAGG - Intronic
1081031655 11:38091694-38091716 TCTTTCCATCTTATTGCACATGG - Intergenic
1083454585 11:62770214-62770236 TCTTTCCCTCACATGTCACAAGG - Intergenic
1083700582 11:64475201-64475223 TCTTTCCCACACATGTGTCAGGG - Intergenic
1086120331 11:83299088-83299110 TATTTCTCAGATATGCCACAGGG + Intergenic
1087994689 11:104789619-104789641 TAATTCCCACATAGGGCATATGG - Intergenic
1091338015 11:134787058-134787080 TTTTTACCACATATGTCTCATGG + Intergenic
1092824110 12:12381434-12381456 TCTTTTCAACATATGGTACAGGG - Intronic
1093189292 12:16056879-16056901 TCTATCCCAAATATGGCAATAGG - Intergenic
1093288737 12:17298032-17298054 TGTTTCCAAAGTATGGCACAAGG + Intergenic
1094695924 12:32818733-32818755 TCTTTGCCACGTAAGGTACACGG + Intronic
1095459820 12:42431379-42431401 TCTTTTCAAAATATGGCAGATGG - Intronic
1095772989 12:45982964-45982986 TATTTCTCACATTTGGCACTTGG - Intronic
1096937050 12:55292276-55292298 CCTGTGCCACATATGGCCCATGG - Intergenic
1098508785 12:71286481-71286503 TCTTTTCAACAAATGGTACAGGG - Intronic
1099018754 12:77377463-77377485 CCTTTTCCCCATATGCCACATGG - Intergenic
1101728055 12:107404306-107404328 TCTTTCCAGCAGATGGGACATGG - Intronic
1102015546 12:109645653-109645675 TCTTTCCCCCATTTGTCAAAGGG + Intergenic
1102793000 12:115663454-115663476 TGTGTCCCACATATTGCATAGGG - Intergenic
1103043705 12:117717641-117717663 TCTGCCCCACACATGCCACATGG - Intronic
1103405816 12:120674530-120674552 TCTTTCCTACAGAGGGGACAGGG + Intergenic
1104603719 12:130171671-130171693 ACTTTTCCACACATGGCACAGGG + Intergenic
1104820762 12:131676004-131676026 CCTTTCCCACATCTGTCCCACGG + Intergenic
1112578357 13:100657410-100657432 TCTTTCCCACATTTTCCACATGG + Intronic
1115374822 14:32663129-32663151 TATTTCCCACATTTGCCAAAAGG + Intronic
1116721205 14:48498137-48498159 CTTTTTCCACATATGGCAGAAGG - Intergenic
1117174517 14:53132952-53132974 CTTTTCCCACATAAGGCAAATGG + Intronic
1118110276 14:62710793-62710815 TATGTCCCAAATATTGCACAGGG - Intronic
1121956954 14:98222981-98223003 TCTGTTCCCCATATGACACAGGG - Intergenic
1122960741 14:105092740-105092762 CCTCTGCCACATATGGCCCAGGG + Intergenic
1124094106 15:26632730-26632752 ACTTTCCCAAGTAAGGCACATGG - Intronic
1124350740 15:28953864-28953886 TCATTCCGACTTGTGGCACAAGG + Intronic
1125075983 15:35619049-35619071 TCTTTCCCACATATTTCATGTGG + Intergenic
1128197326 15:65771460-65771482 TCTATCCCAGATCTGGAACAGGG - Intronic
1128663349 15:69519606-69519628 TCTTTTCAACAAATGGCACTGGG + Intergenic
1128796986 15:70473318-70473340 TCTTTCTAACAGATGGCACTTGG - Intergenic
1130696958 15:86140486-86140508 TCTTTCCAGCACCTGGCACAAGG - Intergenic
1131715327 15:95103922-95103944 TCTTTCCAACAAATGGGACTAGG + Intergenic
1132923611 16:2414812-2414834 TCTTTTCAACAAATGGCACTGGG - Intergenic
1133469504 16:6060910-6060932 TCTTTCCCACATATGGCACATGG + Intronic
1138399109 16:56730898-56730920 TCCTTCCCACGTCTGGCAGAAGG - Intronic
1140121209 16:72084457-72084479 TCTTTCTCAAATAAGGCAGAGGG - Intronic
1140409307 16:74732294-74732316 TCTTTTCCAGCTATAGCACAGGG + Intronic
1144953006 17:19004159-19004181 TCTTTCCCGCAGATTGCTCATGG - Exonic
1145393009 17:22470547-22470569 TCATTGCCACATATGTAACATGG - Intergenic
1147014488 17:37480431-37480453 CCTTTCCCACATCTGCCAGAAGG + Intergenic
1152756690 17:82089996-82090018 TCCTGCCCACATGTGGCCCATGG + Intronic
1153974275 18:10253705-10253727 CCTTTCCCTCCTATGGCACCTGG + Intergenic
1156206807 18:34895108-34895130 TATATCCCACACATGGCTCAGGG + Intergenic
1159535600 18:69711099-69711121 TGTTTTCCATATATGGCACCTGG + Intronic
1161397310 19:4051701-4051723 CCTTGCCCAGATCTGGCACAGGG + Intronic
1167008059 19:46788192-46788214 GCTTTCGGACATCTGGCACACGG - Exonic
928738338 2:34319225-34319247 CCTCTCACACACATGGCACATGG - Intergenic
929822485 2:45284424-45284446 TTTCTCCCACATCTGCCACATGG - Intergenic
930208046 2:48607999-48608021 TCTTTCCCAGAAGTGGAACAGGG + Intronic
930257737 2:49111157-49111179 TCTCTCCAACATATAGAACATGG - Intronic
931315949 2:61131930-61131952 TCTTTTCTACAAATGGCACTAGG + Intronic
931812213 2:65865323-65865345 TTTTTCCAACATATGGCAGAAGG - Intergenic
933839490 2:86275126-86275148 TCTTTCTGTCATATGGCACAGGG - Intronic
937992694 2:127673399-127673421 TCTTACCCTCAAATGACACAGGG - Intronic
938168783 2:129056803-129056825 GCATTTCCACATCTGGCACAGGG - Intergenic
939689406 2:145239066-145239088 TTTGGCCCACATCTGGCACATGG + Intergenic
939754869 2:146097812-146097834 TCTTTTCCACAGATTGCAAAGGG + Intergenic
940137308 2:150452511-150452533 TCTTTTCAACATATGGCACTAGG - Intergenic
940313560 2:152304546-152304568 ACTTTCCCCAATATGGCAAATGG - Intergenic
941174560 2:162180794-162180816 TCTCTCCCACATGTCTCACATGG - Intronic
942632213 2:177963056-177963078 TTTTTCCTACAGAAGGCACAGGG - Intronic
945599933 2:211848251-211848273 CCTATCCCACAGATGACACAAGG - Intronic
945915615 2:215701207-215701229 TCTTTCCCAGAAAGGCCACATGG - Intergenic
945961809 2:216143336-216143358 CCTTTCCTACAAATGGCACAAGG - Intronic
946113716 2:217443701-217443723 TAATTCCCACATGTTGCACAAGG - Intronic
947550408 2:231041525-231041547 TCATCCCCACACCTGGCACATGG - Intronic
948971379 2:241430168-241430190 ACTTTCCCACATTTGGCCCAAGG + Intronic
1168931469 20:1627644-1627666 TGTTTCCCAAAAATGTCACATGG - Intergenic
1173369725 20:42424541-42424563 TCATTCCCAAATTAGGCACAGGG - Intronic
1173699064 20:45050667-45050689 TCTTTACCACATATGTTAAAAGG - Intronic
1176902469 21:14460089-14460111 TATTTGCCACAAATGTCACAGGG - Intergenic
1178072025 21:28978644-28978666 TCTTTCTGACATAAGACACATGG + Intronic
1180701399 22:17783277-17783299 GCTTTCCCACACAGGGCCCAGGG - Intergenic
1181866428 22:25860065-25860087 TCTTTCCAACAAATGGTACTGGG - Intronic
1184130775 22:42515301-42515323 TCCTTCCCACGTCTGGCACAAGG + Intronic
1184140954 22:42577131-42577153 TCCTTCCCACGTCTGGCACAAGG + Intergenic
1184723537 22:46329813-46329835 TCTGTCCCACATCTGGCCCTGGG - Intronic
953108161 3:39906198-39906220 ACTTTCCTACAAATGGGACATGG - Intronic
953283847 3:41585426-41585448 TCTTTTCAACAAATGGCACTGGG + Intronic
957362547 3:79177665-79177687 TCTTTCCCATAAATTGAACATGG + Intronic
959381296 3:105644130-105644152 ACTTTCCCACATAGGGTACTAGG - Intergenic
959817069 3:110686158-110686180 TCTTGCCCAAATATGGCATTTGG + Intergenic
962444131 3:135449810-135449832 TGTTTCCCCACTATGGCACACGG - Intergenic
963711038 3:148747589-148747611 TCTCTCCCTGAGATGGCACAGGG + Intergenic
966771219 3:183505298-183505320 TCCTTGCCAGATATGGCACCAGG - Intronic
968781689 4:2587185-2587207 TTTTTTCCACTTACGGCACAAGG + Intronic
969853713 4:9982356-9982378 TCTTTCCGACTTGTGGCACGTGG - Intronic
970380276 4:15500620-15500642 TCTATCACACATATGGAAGAAGG + Intronic
972248339 4:37270974-37270996 TCTTTTTAACAGATGGCACAAGG - Intronic
975391739 4:73826388-73826410 TTTTTCCAAAATATGACACATGG + Intergenic
976526398 4:86096043-86096065 TCATTATCACATATGGCACTAGG + Intronic
976830252 4:89307503-89307525 TCGGTCCCACATTTTGCACAGGG - Intronic
977043800 4:92045008-92045030 TGTTTCAAACGTATGGCACAAGG - Intergenic
978365251 4:107974559-107974581 GCTTGCTCACATATGGTACATGG - Intergenic
978713885 4:111818481-111818503 TCTTTTCAACAAATGGCACTGGG + Intergenic
979479948 4:121205244-121205266 TCTTTCCCCAATAAGCCACATGG - Intronic
981533888 4:145779421-145779443 ACTTTCCCACACACGTCACAGGG + Exonic
982887094 4:160795385-160795407 TCTTTCCCATAAAAGGCATATGG + Intergenic
983489439 4:168371027-168371049 TTTTTCCCACAAATGTGACATGG - Intronic
989132588 5:38122873-38122895 TCTTTTCCCCATATGGCTTAGGG - Intergenic
989795151 5:45460281-45460303 TCTATCCCTCACATGGCAGAAGG - Intronic
991134148 5:63161625-63161647 TCTTAACCACAAATGGTACAGGG + Intergenic
997719480 5:136066095-136066117 CCTTTCCCACACAGGGGACAGGG + Intergenic
1002348000 5:178561378-178561400 TCTCACCCAAATCTGGCACAGGG - Intronic
1004911205 6:20286598-20286620 TCTTTCCAACAAATGACACTGGG + Intergenic
1004978879 6:20999860-20999882 TTTTTCCCACAAATGTAACAAGG + Intronic
1005416514 6:25605704-25605726 TCTTTCTCAGATCTGGCACAAGG - Intronic
1010875441 6:81099181-81099203 ATTTTCCAACATATGGCATAGGG - Intergenic
1016630179 6:146220690-146220712 TCTTCCCAGCTTATGGCACATGG - Intronic
1017622838 6:156316909-156316931 TCTTTCCTACATGTGGCTGAAGG - Intergenic
1022453047 7:30533787-30533809 TGTTTCCCTCACATGGCCCATGG - Intronic
1023533761 7:41186438-41186460 TCATTCACACATCTGGCAAATGG + Intergenic
1028149663 7:87357222-87357244 GCTTTCCCATATCTGGCAAAGGG + Intronic
1028528852 7:91816111-91816133 TCTTCCCAACAGATGCCACATGG - Intronic
1030920813 7:115383934-115383956 ACTTTCCCAAAAATGGCACTAGG - Intergenic
1031018079 7:116597164-116597186 TCTTTCCCCCATAAGGAAGAAGG + Intergenic
1031536239 7:122936608-122936630 TCATTCCCATATTTGGTACATGG + Intergenic
1031554017 7:123149231-123149253 TGTTTCCTACATATGGTCCAAGG + Intronic
1031832100 7:126640302-126640324 TCTCTCCCACACGTGGCATATGG - Intronic
1033371806 7:140715626-140715648 TCTTTTCCACATGTGGGCCATGG + Intronic
1035594584 8:845891-845913 TCTTTTCCACAGATGGTACCAGG - Intergenic
1038402022 8:27291016-27291038 TCTTTCCAACAAATGGTACTGGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1040586302 8:48745610-48745632 TCTGTCCCAGATAAGGAACAGGG - Intergenic
1042609441 8:70581465-70581487 TCTTTTTAACAAATGGCACAGGG + Intronic
1042661211 8:71156416-71156438 TCTGTCCCACAAATGCCACAAGG - Intergenic
1044070984 8:87759613-87759635 TCTTTCCCACCTATCTCATAAGG - Intergenic
1044819926 8:96149053-96149075 TTTTGCCCACAGATGGCTCATGG - Intronic
1045731167 8:105242635-105242657 TGTTTCCTTCATATAGCACAAGG - Intronic
1045872487 8:106942100-106942122 TCCTTCTCACTCATGGCACATGG + Intergenic
1046071320 8:109258253-109258275 TCTTTTCAACAAATGGCACTGGG - Intronic
1046661008 8:116948557-116948579 TATTTCCCACCTAGGTCACAGGG - Intergenic
1047262152 8:123273541-123273563 TCTTTCCCAAAGTTGGGACATGG + Intronic
1047536518 8:125725095-125725117 CATTTCCCAGAAATGGCACAAGG + Intergenic
1047944543 8:129861897-129861919 ACTTTCCCATATATGGGAAAAGG - Intronic
1048831415 8:138481202-138481224 TCTTTCTCAATTATGTCACATGG + Intronic
1052192146 9:25673410-25673432 TCTTTTCCACACAAGGCAAATGG + Intergenic
1055079233 9:72251424-72251446 TCTCTCCTACGTATAGCACAAGG - Intronic
1056136826 9:83637929-83637951 TTTTTCCCACCTGTGGCCCAGGG - Intronic
1056163103 9:83917716-83917738 TCTTTTCAACAAATGGCACTGGG + Intronic
1056294035 9:85173536-85173558 TCTTGCCCACATGTGGTAGAAGG - Intergenic
1056296685 9:85200369-85200391 TCTTTCCCACAGAGAGAACAGGG - Intergenic
1058674793 9:107391059-107391081 TCTTTCCCAAACATGGAATAAGG - Intergenic
1059645411 9:116261841-116261863 TCTTTAACACATATCGCAAATGG - Intronic
1060519078 9:124283688-124283710 TCTATCCCACAACTCGCACAGGG + Intronic
1060610358 9:124958473-124958495 TCTTTTCAACATATGGTACTAGG + Intronic
1061713480 9:132503628-132503650 TCCTGCCCACCTCTGGCACAAGG - Intronic
1186260819 X:7777172-7777194 TGTGTCCCAAATATGGGACAGGG + Intergenic
1187580994 X:20607106-20607128 TCTTTCCCATAAATGCCACATGG - Intergenic
1189066081 X:37810651-37810673 TCTTTTCCACAAATAGCAAAGGG - Intronic
1189135258 X:38542500-38542522 TCTTTGCCACACCTAGCACAAGG - Intronic
1189862259 X:45285601-45285623 TCTTTTCTACAAATGGCACTGGG - Intergenic
1191253777 X:58271173-58271195 TCTCTCCCTCAGAAGGCACAGGG - Intergenic
1191667351 X:63716998-63717020 TCCATCGCACACATGGCACATGG + Intronic
1192605941 X:72517651-72517673 TCTTTTCCACAAATGGTACTAGG - Intronic
1195837903 X:109139672-109139694 TCTTTTCAACAAATGGTACAGGG + Intergenic
1196924679 X:120621680-120621702 TCTTCCCCTCAGATGGTACAGGG + Intergenic
1198603330 X:138308873-138308895 TCTTTACCATATATGGAGCAAGG + Intergenic