ID: 1133471577

View in Genome Browser
Species Human (GRCh38)
Location 16:6081071-6081093
Sequence TTTTAAATGAATGTGGAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 365}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133471577 Original CRISPR TTTTAAATGAATGTGGAGCA TGG Intronic
900721962 1:4182464-4182486 TTTTAAGTAAGTGTGGAGGAGGG + Intergenic
905116622 1:35646781-35646803 TTTAGAATGAAGGGGGAGCAGGG + Intergenic
905240890 1:36580818-36580840 TTTTAGATAAAAGTGGAACAGGG - Intergenic
905627264 1:39497513-39497535 TTTTCAATGAAGGTGGGTCAGGG + Intronic
909741156 1:79031185-79031207 TTTTATATGAATATTGAGAATGG + Intergenic
910404402 1:86871961-86871983 TTTTAAAAGATTCTGGAGGAGGG + Intronic
910535538 1:88293504-88293526 TTTTAAATTTATGTGGAAAAAGG + Intergenic
911249679 1:95560521-95560543 CATTATATGAAGGTGGAGCAAGG - Intergenic
911281699 1:95937500-95937522 TTTGAAATGAATGTGCATCCTGG + Intergenic
911733719 1:101315214-101315236 TTCTGAATGAATTTGGACCATGG + Intergenic
911936581 1:103983039-103983061 TTAGATATGAATGTGGAGGAAGG + Intergenic
916003649 1:160639525-160639547 GTTAAAATGAGTGTGGAGTATGG - Intronic
916249591 1:162724148-162724170 TATTAGCTAAATGTGGAGCATGG - Intronic
916501823 1:165393945-165393967 TTTTTAATAAATGTGGAACTTGG - Intergenic
916980309 1:170128863-170128885 TTTTTATTGACTGTGGAGTAAGG + Intergenic
917707800 1:177652095-177652117 TTTAAAAGAAATGTGGAGGATGG - Intergenic
917713246 1:177708845-177708867 TTTTAAATGATTGAGAAGGAAGG + Intergenic
918865884 1:189899113-189899135 GTTGAAATCAATGTGAAGCAGGG - Intergenic
919503615 1:198369627-198369649 ATTTAAAGGAATGAGGAGAAGGG - Intergenic
921760730 1:218911169-218911191 TTTTAAAAGAATGTGGATGTTGG + Intergenic
923942833 1:238847190-238847212 TTTCAAATGACTGTTGAGAAAGG + Intergenic
1063243815 10:4197671-4197693 TTTTAAATGAAAGTTTAGCAAGG - Intergenic
1063739611 10:8803841-8803863 TTGTCAATGAATGTTGAACAGGG + Intergenic
1063950589 10:11219138-11219160 TTTTAAGTGAATGCAGAGCTTGG + Intronic
1064455099 10:15480216-15480238 TTTCATATGTGTGTGGAGCAGGG - Intergenic
1064457101 10:15498020-15498042 TTTTAAAAGAATTTAAAGCATGG - Intergenic
1065363108 10:24908092-24908114 TTTAAAATGAATGTTGAATAAGG + Intronic
1065440070 10:25743906-25743928 TTTTAAAAGCATATGGAACATGG + Intergenic
1065662723 10:28022342-28022364 TTTGAAATGAATGTGGGGCATGG + Intergenic
1066022186 10:31314905-31314927 TTTTAAATGCATGTACACCAAGG + Intergenic
1067141922 10:43665442-43665464 GATTAAATGAACGTGAAGCAAGG - Intergenic
1067300784 10:45006881-45006903 TTTGAAATCAATGTGCAACAGGG - Intergenic
1068872487 10:61960109-61960131 TTTTTCATGAATGTGTAGGAAGG + Intronic
1071775102 10:88777923-88777945 TGCTAAATGAATGTGGACAATGG - Intronic
1071946486 10:90651674-90651696 TTTTAAATTATGGTGTAGCAGGG + Intergenic
1073305089 10:102496881-102496903 TTTTAAATGAGTGTGGGGCTGGG + Intronic
1073621581 10:105055005-105055027 TTTCAAATGAATGTATAGCTTGG - Intronic
1073775733 10:106783967-106783989 TTTTAAATGACAGTTAAGCATGG - Intronic
1073989535 10:109246654-109246676 TTTTCAATCACTGTAGAGCAGGG - Intergenic
1074024747 10:109622834-109622856 CTTTAAGTGAAAGTGTAGCAGGG + Intergenic
1074043103 10:109811725-109811747 TTTTTAATGAATGAACAGCATGG - Intergenic
1074231355 10:111539076-111539098 TTTTAAATAACTGTCTAGCAAGG + Intergenic
1074412261 10:113238584-113238606 TTTTAAATGAATGAGTTGTATGG + Intergenic
1074647218 10:115471479-115471501 GTTAGAATGGATGTGGAGCAAGG - Intronic
1076522184 10:131088202-131088224 TTTAAAATGAAAGTGTAACATGG + Intergenic
1077262604 11:1630748-1630770 TCTTAAATGAGTGAGGAGCAGGG - Intergenic
1078942851 11:16028402-16028424 TTTTCTATGAATATGGAGCTTGG + Intronic
1080427205 11:32166881-32166903 TCTAAAATGAATTTGGGGCATGG + Intergenic
1081083639 11:38773396-38773418 TTTTAAATAATTGAGGAGGAAGG + Intergenic
1081636364 11:44725114-44725136 CTTTAAATGTATGTGGCGCCTGG + Intergenic
1082642510 11:55681606-55681628 TTTAAAATTAATTTGGAGAATGG + Intergenic
1084118083 11:67053510-67053532 TTTCAGATGAATGTGGGCCAGGG + Intergenic
1084354808 11:68630867-68630889 TTTTAAATAAGTGCGGAGGAGGG - Intergenic
1085792768 11:79510308-79510330 TGTTAAATGAATGATGAGCAAGG + Intergenic
1087148136 11:94832603-94832625 TTTTATGTGAATCTGGAACATGG - Intronic
1087419444 11:97902407-97902429 TTTTAAATGAACATGTAGGAAGG + Intergenic
1088042129 11:105399590-105399612 TTTAAAATTAATGTGAAGAATGG - Intergenic
1088504033 11:110511904-110511926 ATTTAAAAGAGTTTGGAGCAGGG - Intergenic
1089872491 11:121688250-121688272 TTTAAAATTATTGTGGAGCCCGG + Intergenic
1090703159 11:129314536-129314558 TTATAGATGAATGAGGAACAGGG - Intergenic
1092580508 12:9835856-9835878 TTTTAAGTAAGTGTGGAGGAGGG + Intronic
1092592394 12:9964148-9964170 TTTTAAGTAAGTGTGGAGGAGGG + Intronic
1092978273 12:13767324-13767346 TTTTAAATGAATGGAGCACAGGG - Intronic
1093146293 12:15570650-15570672 TTGGAAATGAATGAGGAGGATGG + Intronic
1093187143 12:16033558-16033580 TTTTACATGATTGGAGAGCAAGG + Intronic
1093504556 12:19850137-19850159 TTGTAAATGGATTTGGAGCAAGG + Intergenic
1094826363 12:34272232-34272254 TTTTAAATAAGTGCGGAGGAGGG - Intergenic
1095157372 12:38874094-38874116 TTTTAAATGAAAGTGGTGGTCGG - Intronic
1095475231 12:42580168-42580190 TTTTAAATGTATCTGGGGCCAGG - Intronic
1096863520 12:54547542-54547564 CTTAAAATGAATCAGGAGCAGGG + Exonic
1096896587 12:54826825-54826847 TTTTAAATTAATGTATATCAGGG - Intergenic
1097742427 12:63259264-63259286 ATGTAAATGAATGGGGGGCATGG - Intergenic
1098258377 12:68641308-68641330 TTTGAAATGAAAGTGGAAGAAGG - Intronic
1099960216 12:89389756-89389778 TTTTCTATAAATGTGGATCACGG - Intergenic
1100117506 12:91325252-91325274 TTTTATATGAGTGTGGTTCATGG + Intergenic
1100835147 12:98559981-98560003 TTTTAAATGATTGTGAGGTAGGG - Intergenic
1100996921 12:100311117-100311139 TTTTGAATAAAAGTGGAGCCTGG + Exonic
1101290988 12:103368946-103368968 TGATTAATGAATCTGGAGCAGGG + Exonic
1102641853 12:114373895-114373917 TTTTACATGATTTTGGAACAGGG + Intronic
1104235638 12:126933745-126933767 TTATAAAAGAATGTGTAACAAGG + Intergenic
1104658390 12:130591358-130591380 TCATAAATGGATGGGGAGCACGG + Intronic
1106030328 13:25996327-25996349 TTTTAAATGTATGTAGAGCTAGG - Intronic
1106200793 13:27535540-27535562 TGTTGAATGAATGTTGAACATGG + Intergenic
1106428941 13:29660845-29660867 ATTTGAATGAGTGTGGAGCAGGG + Intergenic
1106850039 13:33780526-33780548 TTGAAAATAAATGTGAAGCATGG - Intergenic
1106864963 13:33954021-33954043 TTTTAAAGGAATGTCAAGTATGG + Intronic
1106916360 13:34519462-34519484 TTTTAAATTACTGTGGAACTTGG - Intergenic
1107421399 13:40250454-40250476 TTATAAATGGAGGTGGACCAAGG + Intergenic
1107621592 13:42237187-42237209 TTTTGACTTAATGTGAAGCAGGG + Intronic
1108091716 13:46856454-46856476 TTTTAAATGAATGTGAGGCTTGG + Intronic
1109090244 13:58033451-58033473 TTTTACATGAATATAGAACAAGG - Intergenic
1109317058 13:60762362-60762384 TTTTACATGAATGTTCAGCAAGG + Intergenic
1109927117 13:69158216-69158238 TTTTATATGGATGTGGGTCATGG - Intergenic
1110119037 13:71859346-71859368 TTTTAAATGCATTTGGTTCAAGG + Intronic
1110448385 13:75614226-75614248 TTTTACATGAATGTTCATCAGGG + Intergenic
1111081141 13:83309285-83309307 TTTAAAATGAAAGTGGAGAGTGG + Intergenic
1111776143 13:92664480-92664502 TTTTATTTGAAAGTGGAGTAGGG + Intronic
1112377629 13:98858382-98858404 TTTTAAATGTCTTTGGATCATGG - Intronic
1112676405 13:101707342-101707364 ATTTAGCTGTATGTGGAGCAGGG + Intronic
1113024391 13:105924055-105924077 TTTTACATGACTCTTGAGCATGG - Intergenic
1113381563 13:109810379-109810401 TTTAAAATAAATGTGAAGCCAGG - Intergenic
1113696532 13:112350026-112350048 TTTTAAATGAATGGAGAATACGG + Intergenic
1114198371 14:20499482-20499504 TTTTATATGAATGAGAAGAAAGG + Intergenic
1114314146 14:21494241-21494263 TTTTAAATGTGTGTGGGGCAGGG + Intronic
1114700300 14:24671020-24671042 TTTTTAATTAAAGTGGAGTATGG - Intergenic
1115380407 14:32731067-32731089 TTATTAATGAATGTTGATCAGGG - Intronic
1116476735 14:45348866-45348888 TTGTAAGAGAATGTGGAGAATGG - Intergenic
1117932780 14:60862223-60862245 TTTTAAATAAATATTAAGCAAGG + Intronic
1118092796 14:62500741-62500763 TTCTAAAAGAATGTGGAGGCAGG - Intergenic
1118936703 14:70295387-70295409 TTTTAAATAAGTGCGGAGGAGGG + Intergenic
1118969371 14:70620210-70620232 TTTTAAATAAATCCTGAGCATGG + Intergenic
1120804114 14:88727145-88727167 TTTTAAGGCAAAGTGGAGCATGG - Intronic
1121192672 14:92043983-92044005 TTTTAAGTAAGTGTGGAGGAGGG + Exonic
1121362551 14:93274886-93274908 TTTTAAATGAAAGTCTAGAAAGG - Intronic
1121388828 14:93556755-93556777 TTTTAAATGTATGTATAGCTTGG + Intronic
1121689441 14:95865594-95865616 TTTTAAATATATATTGAGCATGG + Intergenic
1121877143 14:97463822-97463844 TTCTAGAGGAAAGTGGAGCAAGG - Intergenic
1121946830 14:98131235-98131257 TTTTGATTGAAGGTGGGGCATGG - Intergenic
1125048668 15:35272611-35272633 GTTTAAAAGAATGTGGGGCCAGG + Intronic
1125146871 15:36480706-36480728 TGTTAAATAAATGAGAAGCAAGG - Intergenic
1126861996 15:52894075-52894097 TTTTAAGTCAATATGGAGCCTGG + Intergenic
1127842408 15:62842654-62842676 TTTTAAATGACTCTGAGGCAAGG - Exonic
1127889897 15:63240854-63240876 TTTTAAATGAATGGAGAGTGAGG + Intronic
1127946419 15:63759024-63759046 TATTAAAGGAAAGTGGAGCCAGG - Intronic
1128383880 15:67133419-67133441 TTTTAAATGCATTTGGGGGATGG + Intronic
1129143568 15:73625768-73625790 TTTTAAATTAATAAGTAGCAAGG + Intronic
1130207626 15:81892227-81892249 TTTTGACTGAATGGGGAGCAGGG - Intergenic
1132338487 15:101063792-101063814 TTTTAAATGAAACTGAAGAAGGG - Intronic
1133471577 16:6081071-6081093 TTTTAAATGAATGTGGAGCATGG + Intronic
1133766222 16:8839896-8839918 TTTTAAATAAGTGTGAAGGAGGG + Intronic
1133974948 16:10594063-10594085 TTTTAAAAGAATTTGGAGGCCGG - Intergenic
1135611121 16:23868129-23868151 TGATAAATGGATGTGGACCATGG - Intronic
1135636597 16:24081575-24081597 TTTTAAAGGCATGTGGGGCTCGG + Intronic
1135855012 16:26001699-26001721 TTTTAAAGGAAAGTTGAGAAAGG + Intronic
1136686986 16:32001313-32001335 TTTTAAATGAGAGTTTAGCAGGG + Intergenic
1136787595 16:32944865-32944887 TTTTAAATGAGAGTTTAGCAGGG + Intergenic
1136882184 16:33908924-33908946 TTTTAAATGAGAGTTTAGCAGGG - Intergenic
1138116314 16:54363406-54363428 TTTTAAAAAAAACTGGAGCAAGG + Intergenic
1138758493 16:59516920-59516942 TTTTAAATAAGTGCGGAGGAGGG + Intergenic
1139385043 16:66561872-66561894 TTTAAAATGGATGTGTAGCGTGG - Intronic
1140910048 16:79442995-79443017 CTTTGAAGGAATGTAGAGCAAGG + Intergenic
1141133281 16:81449155-81449177 TTTTAAGAGAATGTGGCACACGG + Intronic
1203089826 16_KI270728v1_random:1206522-1206544 TTTTAAATGAGAGTTTAGCAGGG + Intergenic
1144529763 17:16025790-16025812 TTTTAACTGAATGTGTCCCAAGG + Intronic
1145721782 17:27080097-27080119 TTCAAAATGCATGTGGACCAGGG + Intergenic
1146538735 17:33676116-33676138 TTTTATATGGATGTGGCTCATGG - Intronic
1146551178 17:33781629-33781651 CTTTAATTCTATGTGGAGCAGGG - Intronic
1147517864 17:41139221-41139243 TTTTTTATGAATATGGAGAAGGG - Intergenic
1148566775 17:48637554-48637576 TGTTAAATTCTTGTGGAGCAAGG + Intergenic
1149528641 17:57377669-57377691 TTTTAAAGTAATGAAGAGCAAGG - Intronic
1150889659 17:69133002-69133024 TTTAAATTGAATGTGGAGTGGGG + Intronic
1150987053 17:70210606-70210628 TTAAAAATAACTGTGGAGCATGG - Intergenic
1151269723 17:72984818-72984840 TGTTAAATGAATAAGGAGGAAGG + Intronic
1153884240 18:9448788-9448810 TTTTAGATGCTTGTGGACCATGG - Intergenic
1156730140 18:40183904-40183926 ATTTAAACACATGTGGAGCATGG - Intergenic
1157466856 18:47954723-47954745 TGTTAAATGAAGATGAAGCAAGG - Intergenic
1157757829 18:50234388-50234410 TGTTATATGAATGTGGGGCCTGG - Intronic
1158243979 18:55409974-55409996 TTTTAAATGACTGTGGATGAAGG - Intronic
1158394139 18:57066600-57066622 TTTTAAATAAGTGCGGAGGAGGG + Intergenic
1159460827 18:68720899-68720921 TTTTAAATTATTGTGGAGACAGG - Intronic
1160002948 18:75044902-75044924 TTTAAACTGAGTGTGGAGTATGG - Intronic
1161437199 19:4270692-4270714 TTTTAAAGAAAGGTGGGGCACGG + Intergenic
1162700766 19:12513351-12513373 TTCTAAATGTATGGGAAGCAGGG - Intronic
1167376267 19:49114091-49114113 TGTTGAATGAATGTGGGGAAAGG + Intergenic
926856879 2:17266459-17266481 ATTCAAATGAATGTGTAGTAGGG + Intergenic
928686928 2:33759513-33759535 TTTTAATTGCATGTGGATTAAGG + Intergenic
929956979 2:46465541-46465563 TTTTAAATGCTTGGGTAGCAGGG - Intronic
930308377 2:49705782-49705804 TTTTAAATGTAATTTGAGCAAGG - Intergenic
931355147 2:61530710-61530732 TTTTAAAGGAATGTGTAACTTGG - Intronic
931474152 2:62570865-62570887 TTTTAAATGCATATGAATCAGGG + Intergenic
932537942 2:72619495-72619517 TTTAAAAAGAATGAGGAGGAGGG + Intronic
934972265 2:98773189-98773211 TTTTGGATAAATGTGGAGGATGG - Intergenic
935336680 2:102023133-102023155 TTTTAAAAGACTGTGCAGCCAGG - Intronic
935422632 2:102885890-102885912 TTTTGAAAGAATGTGGGGCATGG + Intergenic
936061845 2:109299847-109299869 TTTTAATTGAATGTTCAGCCTGG - Intronic
936659277 2:114524211-114524233 TCTTAAAGAAATGTGGAGGATGG + Intronic
937582860 2:123509926-123509948 CTTTAAATAAATGTAGAGAATGG - Intergenic
937696795 2:124817327-124817349 TTGTAAAAGCATATGGAGCATGG + Intronic
938581506 2:132650697-132650719 TTTTAAAGGAAGGAGGAGGAAGG - Intronic
938735391 2:134181328-134181350 GTTTACATGAGTGTAGAGCAGGG - Intronic
939202188 2:139051312-139051334 TTTAAAATGCATGGGGAGTAAGG + Intergenic
939681945 2:145147084-145147106 ATTTTAATGAATTTGGAGCATGG - Intergenic
940402911 2:153267617-153267639 TGTTGAATGTATCTGGAGCATGG - Intergenic
940465950 2:154026731-154026753 TTTTGAATGTATTTGGAGCTAGG - Intronic
940476997 2:154175703-154175725 TTTAAAATAAATGTGTAGTAGGG + Intronic
940530633 2:154872608-154872630 TTTCAAATAAATGTGGAGGAGGG - Intergenic
940770784 2:157837503-157837525 TTTTAATTTAATTTCGAGCACGG + Intronic
940933209 2:159461140-159461162 TTTTACATGTATGTGGAGATAGG + Intronic
941400516 2:165024638-165024660 TTTTAAAAGAACTTGGAGAAAGG - Intergenic
941767963 2:169318653-169318675 TTCTTTATAAATGTGGAGCAGGG - Intronic
942008557 2:171734933-171734955 TTTAAAATGAAATTGGAACAAGG - Intronic
942028256 2:171932570-171932592 ATTTAAATGACTGTAGAGCGAGG + Intronic
942105143 2:172626496-172626518 TTTGAAATTAATGTGTTGCAGGG + Intergenic
944041070 2:195355475-195355497 CTTTAAATGAAGGTTGGGCATGG + Intergenic
944380032 2:199097954-199097976 TTTTAAATGTAGGTGAAGCCAGG + Intergenic
944459211 2:199928115-199928137 TTTTAAACAAATGTGGACAAAGG - Exonic
944611436 2:201412737-201412759 TTTTGAATAAAAGTGGAGCCTGG - Intronic
945324187 2:208463698-208463720 TTTTAAGTTAATGTGTTGCAGGG - Intronic
946876374 2:224133770-224133792 AATTAAATGAGTTTGGAGCAAGG - Intergenic
948034192 2:234844667-234844689 TTTTAAAAATACGTGGAGCATGG + Intergenic
948250391 2:236523844-236523866 TTTTAGAGGAATGTGGATGAGGG - Intergenic
1170905184 20:20508869-20508891 TTTTAAGTGAAGGTTGATCAAGG + Intronic
1172092600 20:32444787-32444809 TTTTAAATGGCTGTGGGACAAGG + Exonic
1173229663 20:41184202-41184224 TCTGAAATGAGTGTGGAGAAAGG + Exonic
1175541331 20:59749935-59749957 TGCTAAATGATTGTGGACCAGGG + Intronic
1175672430 20:60916941-60916963 TTTAAGATGACTGTGGAGCCAGG + Intergenic
1175690759 20:61064581-61064603 TTTTAATTGCAGGTGGAGTAAGG - Intergenic
1176651149 21:9548377-9548399 TATTAAATAATTGTGAAGCAAGG - Intergenic
1176703331 21:10085986-10086008 TTTTAGATGAATGATGTGCATGG - Intergenic
1177045801 21:16168270-16168292 ATCTAAATGGATGTGGAGGAAGG - Intergenic
1177199722 21:17940688-17940710 ATTTAAAAGAATGCGTAGCATGG + Intronic
1178176664 21:30107977-30107999 TTTTAAATAAATATAGAGCTGGG - Intergenic
1178490095 21:33044469-33044491 TGTTAAATGGAAGTAGAGCAGGG - Intergenic
1178711123 21:34917706-34917728 ATTGAAATGAATGTGGGGCTTGG + Intronic
1178807191 21:35849085-35849107 TTTTAAATGCATTTGCAGTAGGG + Intronic
1179681588 21:43025331-43025353 TTTTGTATGAATGTGGGGCTTGG - Intronic
1184310505 22:43638180-43638202 TTAGAAATGAAAGTGGTGCAAGG - Intronic
949149109 3:742985-743007 TTTTAAGTGAATGTGTATTATGG + Intergenic
949439201 3:4062220-4062242 TTTCAAATGTATTGGGAGCATGG + Intronic
950957225 3:17067045-17067067 TTTTACATGTATGTGGTGGAGGG - Intronic
951473695 3:23082394-23082416 TTTTACACAAAAGTGGAGCATGG + Intergenic
954533971 3:51344153-51344175 CTTCAAATGAGTGTGGACCATGG - Intronic
955570229 3:60296810-60296832 TTTTGAATGAATTTTGTGCAAGG + Intronic
956130541 3:66049387-66049409 TTTTAAATGTAGGCTGAGCATGG + Intergenic
956776228 3:72567836-72567858 TTATAAATGAACGTGGATAATGG + Intergenic
956925339 3:73980957-73980979 GTTTAAAAAAATTTGGAGCATGG + Intergenic
957365453 3:79216694-79216716 TTTTAAATGCATCTTGAGAAGGG - Intronic
957553225 3:81733446-81733468 TTTTCCATGAATGGGGGGCAGGG - Intronic
958024734 3:88037563-88037585 TTTGAAATCAAGGTGCAGCAGGG - Intergenic
959168874 3:102819756-102819778 TTTTAAATGACTGGAGGGCAGGG - Intergenic
959499080 3:107084905-107084927 TTTTAAAAGAATTTGAGGCAGGG - Intergenic
960449248 3:117786079-117786101 TTTTAGATGACTTTGTAGCAGGG + Intergenic
960934871 3:122892616-122892638 TTTTAAATGAATGAGGACAGGGG - Intergenic
962893541 3:139693681-139693703 TTTTTAAAGAAGGTGTAGCAGGG - Intergenic
963332678 3:143932897-143932919 TTTTAAATCAATGTTCATCAAGG - Intergenic
963559309 3:146841878-146841900 GTTAAAATGAATCAGGAGCAGGG + Intergenic
963938944 3:151081820-151081842 TTTTAAATGAGAGTGAAGAATGG - Intergenic
964249700 3:154698804-154698826 TTTTAAATTATAGTGGAGCCTGG + Intergenic
965625885 3:170683756-170683778 TTTTAAATAAGTGCGGAGGAGGG + Intronic
966067441 3:175834245-175834267 TTTTAAATAAGTGCGGAGGAGGG - Intergenic
966246680 3:177816310-177816332 CTTTAAATAAATTTGGTGCAAGG + Intergenic
967254861 3:187580202-187580224 TTTTAAATGTATTTTAAGCATGG + Intergenic
968780208 4:2574692-2574714 CCTTAAATAAATGTGGAGCTGGG + Intronic
968877415 4:3280237-3280259 TTTTAAATGAATTTGTGTCAAGG + Intergenic
970435489 4:16030441-16030463 TTTTAACTGAATGTGTAGGAGGG + Intronic
970487019 4:16535079-16535101 TTTTCCATGCATCTGGAGCAAGG + Intronic
970767253 4:19564419-19564441 TGTTAACTGAATGTGAGGCAGGG - Intergenic
970972469 4:22000341-22000363 TTTTACATGAATGTTCATCAGGG - Intergenic
971235201 4:24835225-24835247 TTTTAAATAAAGGTGGTGCATGG + Intronic
971994755 4:33950950-33950972 TAATAAATGTATGTGGGGCAGGG + Intergenic
972815148 4:42636789-42636811 TTTTAAGTCAATGAGGAGCATGG - Intronic
974229802 4:59095092-59095114 TTTTAAATGAATGAATATCAAGG + Intergenic
975871565 4:78784937-78784959 TTTTAGATAAATGAGGAGCATGG + Intronic
976402930 4:84628008-84628030 TTTTAAATGAATATGCATCGTGG - Intronic
977174860 4:93807679-93807701 TTATAAATGAATGTGGAAGTGGG - Intergenic
977701300 4:100026028-100026050 ATTTAAATCAATCTGGAGCTGGG - Intergenic
977887153 4:102265369-102265391 TTTTATACGAATGTGGTTCATGG + Intronic
978066569 4:104411561-104411583 TGTTAAATGAATGGGAAGCAGGG - Intergenic
978166722 4:105618286-105618308 ATATAAATAAATGTGGAGAAAGG + Intronic
979117488 4:116844956-116844978 TTTTAAATGAATTTGGGATATGG + Intergenic
979394572 4:120171100-120171122 TTTTAAAAAATAGTGGAGCATGG - Intergenic
979780787 4:124649360-124649382 TTGTAAAAGAATGTGGAGGCAGG + Intergenic
979791769 4:124792426-124792448 TTTTAAATCAATGTTCATCAGGG + Intergenic
979797074 4:124859127-124859149 ATTTAAAGGAATGTGGAACACGG + Intergenic
980375546 4:131942353-131942375 TTTTAGATGAATGATGTGCATGG - Intergenic
980547741 4:134290811-134290833 TGTTAAAAAAATGTGGAGGATGG - Intergenic
981598830 4:146461142-146461164 CTTTAAATAAATGTGAAACAAGG - Intronic
982268521 4:153563227-153563249 TTTTATAAAACTGTGGAGCATGG + Intronic
982421382 4:155202264-155202286 TTTTAAATGAATCTTGTGTATGG - Intergenic
982666830 4:158275643-158275665 CTTAAAATTAATGTGTAGCATGG - Intergenic
983562919 4:169118954-169118976 ATTTAAATGAATTTGGAATATGG - Intronic
983721138 4:170852896-170852918 GTTTGAATGAGTGTGAAGCAAGG + Intergenic
984509017 4:180656450-180656472 TTATAATTGGATGTGGAGAAAGG - Intergenic
984631769 4:182068211-182068233 TTTTTAATGGATTTGGAGCCAGG + Intergenic
986481752 5:8196476-8196498 TTTTAAATAAATGTTGACTATGG + Intergenic
990542472 5:56787983-56788005 TTTTAGCTGATTATGGAGCAGGG + Intergenic
990732129 5:58820823-58820845 TTATAAATCATTGAGGAGCAGGG + Intronic
990813167 5:59751832-59751854 TTTGATATGAATGTGAAGCATGG - Intronic
991029904 5:62071907-62071929 TTTTATAGGAGTGTGGAGCCTGG + Intergenic
993027104 5:82660021-82660043 TTTTGAAGTAATTTGGAGCAAGG + Intergenic
993580048 5:89649853-89649875 TTTTACATCAGTGTGTAGCAGGG + Intergenic
994126696 5:96175354-96175376 TTTTTAATGCATGTGAAACAAGG - Intergenic
994258888 5:97633604-97633626 ATTTTAATGAATTTGGAGCATGG - Intergenic
995084742 5:108095090-108095112 TTTTAAATGAATGTTGTAAATGG - Intronic
995124809 5:108569564-108569586 TTTTAAGTAAGTGTGGAGGAGGG + Intergenic
995463286 5:112424797-112424819 TTTTAAAAGAAAGGGGAGCTAGG - Intergenic
995538005 5:113156766-113156788 TGTAAAATGAATGTGAAGCAGGG - Intronic
995788348 5:115855852-115855874 TTTTAAAAGAATGATGAGGATGG + Intronic
997192489 5:131950641-131950663 TTTAAAATGAATGTGAAGAATGG - Exonic
997391764 5:133522996-133523018 TTTAACATGAATGTGGGGTAGGG - Intronic
998876337 5:146603932-146603954 TTATAAATGAATGCTCAGCAAGG - Intronic
998971066 5:147593167-147593189 TTTTGATGGAGTGTGGAGCAAGG - Intronic
1000494022 5:161955546-161955568 TTTGAAATGTATCTGGAGGAAGG - Intergenic
1000809809 5:165847034-165847056 TTTAAAGTGAAAGTGGAGAAAGG - Intergenic
1000859145 5:166435372-166435394 TTGTAAATGAATTTGTAACATGG + Intergenic
1001692491 5:173643460-173643482 TTTGAACAGAATGTGGAGCGGGG + Intergenic
1001920662 5:175596879-175596901 TTTCAAATGAGTGAGGAGCCAGG - Intergenic
1003807931 6:9747256-9747278 TTTTAAATTCATCTGGAACAAGG + Intronic
1004111612 6:12723990-12724012 CTTTAAATGAATTTGAACCATGG + Intronic
1004634372 6:17452934-17452956 TTTTAAAAAAAAGTGGAGGAGGG + Intronic
1005494900 6:26379865-26379887 TGCTAAATAAATGTGGTGCAGGG - Intergenic
1005499339 6:26416453-26416475 TGCTAAATGAATGTGGTGCAGGG - Intergenic
1005912600 6:30324549-30324571 TTTTAAATGACTGGGGAGGGAGG + Intergenic
1006227857 6:32555571-32555593 TTTTAAAGCAATGTGGATAAAGG + Intronic
1006325342 6:33349494-33349516 TTTTAAGTAAGTGTGGAGGAGGG - Intergenic
1007941405 6:45785012-45785034 TTTTAAATGATTGAGGACCATGG - Intergenic
1008794787 6:55289895-55289917 CTTTAAATGCATCTGTAGCAAGG + Intergenic
1008853805 6:56056542-56056564 TTTTAACTGATTGTTGAGTATGG - Intergenic
1010586105 6:77659961-77659983 TTTTAAATAAGTGTGAAGGAGGG + Intergenic
1011125383 6:84001930-84001952 TTTTAAAATAATGTGGAAAAGGG - Intergenic
1012107300 6:95179297-95179319 TTTTACATTACTATGGAGCATGG - Intergenic
1012634812 6:101524645-101524667 TTGTAAAATATTGTGGAGCAAGG - Intronic
1012831630 6:104210781-104210803 TTTCAGATGAATGAGGAACACGG + Intergenic
1012916192 6:105173666-105173688 TTATAAATGAAAGTGTAGCATGG - Intronic
1013191197 6:107805493-107805515 ATTTAAATGAAAGTGAAGGATGG + Intronic
1014425910 6:121305934-121305956 TTTTAAATTATTATGCAGCAAGG - Intronic
1015911967 6:138178061-138178083 ATTTAAATGCATTTGGAGCAAGG + Intronic
1016004674 6:139077454-139077476 TTTTCAATAAATCTGCAGCATGG + Intergenic
1016205058 6:141458768-141458790 TTTTAAATAAGTGTGGAGGAGGG - Intergenic
1016281149 6:142420375-142420397 TCATGAATGAATATGGAGCAAGG + Intronic
1018216890 6:161537275-161537297 TTTTTAAAGAATGTAGAGCTTGG - Intronic
1022835163 7:34106434-34106456 GAGAAAATGAATGTGGAGCATGG + Intronic
1023101222 7:36720663-36720685 TTTAAAATGAATGTTGAACTGGG - Intronic
1024527277 7:50359589-50359611 TTTTAAATATATGTGTAGAAAGG + Intronic
1024721934 7:52147168-52147190 GTTAAAATTAATGAGGAGCAAGG + Intergenic
1024798574 7:53049295-53049317 GTTTAAATGGTTGTGGGGCAGGG + Intergenic
1027047376 7:75000053-75000075 TTTTAAATGTTTGTGGAGACGGG - Intronic
1027457504 7:78411835-78411857 ATTTAAATGAATAAGGAGAAAGG + Intronic
1028993930 7:97078747-97078769 TTTTAAATGTAAGTAGAGAAAGG + Intergenic
1029385613 7:100241576-100241598 TTTTAAATGTTTGTGGAGACGGG + Intronic
1031346964 7:120679711-120679733 TTTAAAAAGAATGTGGAACTTGG - Intronic
1031647662 7:124246336-124246358 TTTTAAATGAAAGAGGAAGAAGG - Intergenic
1033729941 7:144168191-144168213 TTTTACATGAATGGGGGTCAGGG - Intergenic
1034297739 7:149989133-149989155 TTTTAAATGAACATGGAGGTTGG - Intergenic
1034808283 7:154107720-154107742 TTTTAAATGAACATGGAGGTTGG + Intronic
1034877901 7:154741609-154741631 TTTTTAATGAATGTTAACCAAGG + Intronic
1036130679 8:6106872-6106894 TATTAACTCAATGTGGATCAAGG - Intergenic
1037507387 8:19544649-19544671 TCTTAAAGTAATGTGGAACAGGG + Intronic
1038510163 8:28126322-28126344 TTTTTAAAAATTGTGGAGCAGGG - Intronic
1039458253 8:37722266-37722288 ATTTAAATGAATGAGCAGCCAGG - Intergenic
1042249114 8:66738345-66738367 TTTTAAAGCAATATGGAGAATGG - Intronic
1042749424 8:72141606-72141628 TTCTACCTGAATGTGGTGCAAGG - Intergenic
1043151252 8:76718999-76719021 CTTTCAATGAATGTAGAACATGG + Intronic
1043587578 8:81786871-81786893 TTTTAAAAAGATGTTGAGCAAGG + Intergenic
1043650803 8:82589099-82589121 TTTTCATGGAATGTGGAGAATGG + Intergenic
1044003008 8:86908135-86908157 TGTTAAGTCCATGTGGAGCAAGG + Intronic
1044789071 8:95827677-95827699 TTTTCTATGACTGTGGATCAAGG - Intergenic
1045867649 8:106886719-106886741 TTTTAAAAGTATGTTGACCAGGG - Intergenic
1045979979 8:108173282-108173304 TTTAAAATGTATATGGAGCTGGG - Intergenic
1046066164 8:109199193-109199215 TTTTAAATGAATTTAAAGTATGG + Intergenic
1046403607 8:113741443-113741465 TATGAAATGAATTTGGAGAACGG + Intergenic
1046645696 8:116783090-116783112 TTGTAAATGTATGTGGATTATGG + Intronic
1047165563 8:122434371-122434393 TTTTCAAAGAATGTGGTTCATGG - Intergenic
1047420360 8:124702868-124702890 TTTTAAATCATTGTGGTGAAGGG - Intronic
1047421773 8:124713357-124713379 TTTTCAAGAAATGTGGAGCATGG - Intronic
1048948197 8:139470299-139470321 AATCAAATAAATGTGGAGCAAGG - Intergenic
1050748446 9:8906309-8906331 TTGTAAAAGAATTTGGAACAAGG - Intronic
1051480050 9:17549895-17549917 TTTTAAATAAACTTGGATCATGG + Intergenic
1051972609 9:22909138-22909160 TTTTAAATGATTTTTGAACAAGG - Intergenic
1052065906 9:24019550-24019572 TTTTAAATGAATGTGTATTTTGG + Intergenic
1052623703 9:30946372-30946394 TTATAAATGAATTTAGAACAAGG - Intergenic
1052641705 9:31175901-31175923 ATTTACATGAATGTTGTGCATGG + Intergenic
1052653918 9:31332693-31332715 TTTTAAATAAGTGCGGAGGAGGG - Intergenic
1053640596 9:40072996-40073018 TTTTAGATGAATGATGTGCATGG - Intergenic
1053765542 9:41392470-41392492 TTTTAGATGAATGATGTGCATGG + Intergenic
1054544154 9:66303629-66303651 TTTTAGATGAATGATGTGCATGG + Intergenic
1056304775 9:85279247-85279269 TTTAAAATGGATGTGGATTATGG - Intergenic
1056387050 9:86105784-86105806 TTTTAAATGACTTTTGAGAAAGG + Intergenic
1056717473 9:89044208-89044230 TTTTAAATGTGTGTAGAACAAGG + Intronic
1056738697 9:89234070-89234092 TTTTAAATGATTGTTGAATATGG + Intergenic
1057286613 9:93760843-93760865 ATTTAAATAAAAGTGGAGTAAGG - Intergenic
1057994186 9:99805179-99805201 TTTCAAATGAGTTTGGAGCCTGG + Intergenic
1059535011 9:115072394-115072416 TATAAAATGAATCTGGAGCTGGG - Intronic
1059790323 9:117635559-117635581 CTGTAAAGGAATGTGGAGCCTGG - Intergenic
1059799585 9:117736808-117736830 TAGAAAATGAATATGGAGCAAGG - Intergenic
1060671052 9:125470035-125470057 TGAGAAAAGAATGTGGAGCACGG - Intronic
1202788363 9_KI270719v1_random:56091-56113 TTTTAGATGAATGATGTGCATGG - Intergenic
1203628884 Un_KI270750v1:51927-51949 TATTAAATAATTGTGAAGCAAGG - Intergenic
1186744421 X:12552564-12552586 TTTCAAGTGAATTTGAAGCATGG - Intronic
1188222455 X:27557995-27558017 TTTAAGATGAAAGTGGAGGAGGG - Intergenic
1189140402 X:38599357-38599379 TTTTAAATAAGTGTGGAACTTGG - Intronic
1191073122 X:56423535-56423557 ATGTAAATGAATGTAGAGTATGG + Intergenic
1191761924 X:64655635-64655657 TTTTAAATAAGTGCGGAGGAGGG - Intergenic
1192785863 X:74334818-74334840 TTTTAAATGTTTGTGGAGACAGG + Intergenic
1193536732 X:82726435-82726457 TTTTATAAGAATGTGGACCTTGG - Intergenic
1194012869 X:88584032-88584054 TTTGGAATCAATGTGGAGCTAGG + Intergenic
1194138412 X:90177245-90177267 TTTCAAATGTATGTGTAGCTTGG + Intergenic
1194831390 X:98626579-98626601 TTTTCAATGAATGAGGAGATAGG + Intergenic
1195219929 X:102737166-102737188 TTTTAAATGTATGTATAGCTTGG + Intronic
1196104911 X:111885225-111885247 TTCTAATTTAATGTGTAGCAAGG + Intronic
1196977056 X:121170440-121170462 TTTTAAATTAATGTGGGTTAGGG - Intergenic
1197068055 X:122257901-122257923 TTTTACATGAATGTTCATCAGGG - Intergenic
1197272374 X:124438875-124438897 GTTTAAATAAATTTGGAGAAAGG + Intronic
1199344892 X:146727139-146727161 TTTTAAAAGAGGCTGGAGCATGG - Intergenic
1199393054 X:147304507-147304529 CTTTAAGTAAATGTGGAGAAAGG - Intergenic
1199715771 X:150506418-150506440 TTTATAAAGAATGTGGAGGAAGG - Intronic
1200843834 Y:7811276-7811298 TATTAAATCACTGTGGAGCTGGG + Intergenic
1201233691 Y:11890346-11890368 TTTTAAGTAAGTGTGGAGGAGGG + Intergenic