ID: 1133471781

View in Genome Browser
Species Human (GRCh38)
Location 16:6082735-6082757
Sequence CTCAAATAGAACTAGGGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133471777_1133471781 21 Left 1133471777 16:6082691-6082713 CCCAAGGAAGGGACAATGTTCTC 0: 1
1: 0
2: 2
3: 10
4: 160
Right 1133471781 16:6082735-6082757 CTCAAATAGAACTAGGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 146
1133471778_1133471781 20 Left 1133471778 16:6082692-6082714 CCAAGGAAGGGACAATGTTCTCT 0: 1
1: 0
2: 0
3: 23
4: 196
Right 1133471781 16:6082735-6082757 CTCAAATAGAACTAGGGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133471781 Original CRISPR CTCAAATAGAACTAGGGCTG AGG Intronic
901011292 1:6203955-6203977 CACAAATAGAACCAGGGCTAGGG + Intronic
904151390 1:28444513-28444535 CCCAAATAGGCCAAGGGCTGTGG - Intronic
904351168 1:29907704-29907726 CTGCAATATCACTAGGGCTGGGG + Intergenic
907618096 1:55945543-55945565 CTCAAAAAGACCTAGGGCTGTGG - Intergenic
911778335 1:101843267-101843289 CTCAAATAGCCCTACTGCTGTGG - Intronic
916573260 1:166045639-166045661 TTCCAATAGAAGTGGGGCTGAGG + Intergenic
917922866 1:179765489-179765511 CTAAAATAGAATTAGTGCTGGGG + Intronic
918198265 1:182242930-182242952 GTCAAATGGAACTTGGGCTATGG + Intergenic
921102811 1:211945169-211945191 CTCAAATAGAACTGAGGTTTGGG - Intronic
1066746333 10:38605858-38605880 CCCAAATAGGACTAGGGGAGGGG + Intergenic
1071346117 10:84695538-84695560 CTGAAAGAGAAATAAGGCTGGGG - Intergenic
1078765314 11:14290961-14290983 CTGAAATAGAACAATTGCTGGGG + Intronic
1081939422 11:46928227-46928249 CTAACATAGAGCTTGGGCTGTGG + Intergenic
1084884606 11:72195533-72195555 CCCGAATAGAACTGGAGCTGGGG - Intronic
1087609785 11:100420581-100420603 CTCCAAGAGAACAAGTGCTGGGG + Intergenic
1087839286 11:102905931-102905953 CTCTAAAAGTACTAGGGCAGCGG + Intergenic
1088426965 11:109714859-109714881 CCAAAATAGAGCTTGGGCTGTGG - Intergenic
1088745505 11:112801060-112801082 CCCAAATAGAAAGGGGGCTGGGG + Intergenic
1088932557 11:114366578-114366600 CCCAAAAAGAACAAGGGCTGAGG + Intergenic
1094454857 12:30620808-30620830 CTCAAAAAGAATTATGGCTTTGG + Intergenic
1095845341 12:46737862-46737884 CTCCAACAGAACTGGAGCTGAGG + Intergenic
1097054298 12:56240649-56240671 TTCAAAAAACACTAGGGCTGGGG + Exonic
1098752387 12:74311244-74311266 CTTAAATTGAACTGGGGCTGAGG - Intergenic
1100494613 12:95112817-95112839 CTTAAGTACTACTAGGGCTGAGG + Intronic
1101926612 12:108977065-108977087 CTCAAATAATCCTAGGGATGTGG + Intronic
1103871787 12:124097511-124097533 AGCAAAAAGAAATAGGGCTGAGG - Intronic
1107122517 13:36811320-36811342 TTCACATAGAACAGGGGCTGTGG - Intergenic
1109407043 13:61914869-61914891 CTCAAATAGGACTATGGATGAGG + Intergenic
1109571993 13:64204922-64204944 CTCAGAGAGAACTAGGACTAGGG - Intergenic
1110107830 13:71700835-71700857 CTCAGATAGAATCAGGGATGTGG - Intronic
1111539340 13:89650625-89650647 CCAAAGTAGAACTTGGGCTGTGG - Intergenic
1112448510 13:99488957-99488979 CTCTAATAGAACCAGTGCAGAGG - Intergenic
1121358645 14:93235214-93235236 CTCAAAAGCTACTAGGGCTGGGG - Intergenic
1128824205 15:70696020-70696042 CTCAAGTAGAAATAGAACTGAGG + Intronic
1133471781 16:6082735-6082757 CTCAAATAGAACTAGGGCTGAGG + Intronic
1140723576 16:77791808-77791830 CTCAAAAAGAACTGTTGCTGGGG + Intronic
1145086831 17:19949844-19949866 TAAAAATAGAACTAGGGATGAGG - Intronic
1153166503 18:2267734-2267756 CTGAAATAGAATTTGAGCTGTGG - Intergenic
1153545228 18:6197932-6197954 GTCAGACAGAACTGGGGCTGGGG + Intronic
1153878633 18:9400332-9400354 CTTAAAGAGCACTAGGGATGGGG + Exonic
1156796564 18:41053264-41053286 CTATAATGGAACAAGGGCTGTGG - Intergenic
1157182955 18:45513701-45513723 CTCAATAAGAGTTAGGGCTGTGG + Intronic
1158222048 18:55160229-55160251 CCCACATAGAGCTCGGGCTGTGG + Intergenic
1162831453 19:13286949-13286971 CTCAGAGAGAACCAGGGCTCCGG - Exonic
1163066218 19:14798006-14798028 CTCAGTTAGAAATAGGGCTGCGG + Intronic
1164867688 19:31618535-31618557 TTCAAATAGCACCAGGTCTGAGG + Intergenic
1164979608 19:32603983-32604005 CTCAGCTAGCAGTAGGGCTGTGG - Intronic
1165382278 19:35489853-35489875 CTCAAAGAGGAGTGGGGCTGGGG - Intronic
1165420406 19:35719402-35719424 CTCAGATGGAACGAGGGCTTTGG + Intronic
1166353000 19:42209444-42209466 CACAAATGAAACTAGGGCAGGGG + Intronic
1167412391 19:49352534-49352556 CTCAAAAAAAAATAGAGCTGGGG - Intronic
925898894 2:8494595-8494617 CTCATTTAGAAATAGGACTGGGG - Intergenic
929460458 2:42099236-42099258 TTCAAATAAAACCAGGGCTTGGG - Intergenic
931205004 2:60138520-60138542 CTCAAATATAGATAAGGCTGTGG + Intergenic
934187874 2:89762901-89762923 CCCAAATAGGACTAGGGGAGGGG - Intergenic
934308737 2:91845046-91845068 CCCAAATAGGACTAGGGGCGGGG + Intergenic
934638151 2:96009769-96009791 CTCAAATAGAAGTCGGGCCATGG + Intergenic
934795500 2:97095641-97095663 CTCAAATAGAAGTCGGGCCATGG - Intergenic
936501674 2:113071870-113071892 CGCAAGTATGACTAGGGCTGAGG - Intronic
938242304 2:129752852-129752874 CTCAAAGAAAACTTTGGCTGAGG + Intergenic
939236075 2:139495231-139495253 GTCAAATAGAACTAGGGAAATGG + Intergenic
940264439 2:151821562-151821584 CTCAAATAGAGCTACGTCTTGGG - Intronic
940770935 2:157838925-157838947 CTCAAAAAGGAGTGGGGCTGAGG - Intronic
940842589 2:158601159-158601181 CTCAAATGGGGCAAGGGCTGTGG - Intronic
941158516 2:162008176-162008198 GTCAAATACAAGTAGGGCTTTGG - Intronic
941552337 2:166932979-166933001 CTGAAGAAGAACTAGGGTTGAGG - Intronic
941552416 2:166933723-166933745 CTGAAGAAGAACTAGGGTTGAGG + Intronic
943720519 2:191199191-191199213 CTCATATGGAAGTAGGTCTGAGG - Intergenic
945712287 2:213313451-213313473 GTAAAATAGAAATATGGCTGTGG - Intronic
946484322 2:220086402-220086424 CACAAAAAGAAGTAGAGCTGGGG - Intergenic
948039627 2:234889166-234889188 CTCAAATAGACCTGCAGCTGAGG + Intergenic
948235720 2:236388889-236388911 CTCAAATAGACCTGCAGCTGAGG - Intronic
948636054 2:239338306-239338328 CTCTAATACAACTGGGGCAGCGG + Intronic
1169766407 20:9152458-9152480 CTAACATAGAGCTTGGGCTGTGG + Intronic
1171432933 20:25096741-25096763 CTGAAATAGAACAAGGCCAGAGG + Intergenic
1174606424 20:51765179-51765201 CTGAAATAGAACTAGGGGCTGGG - Intronic
1175058321 20:56218489-56218511 CCCAAATGGCAATAGGGCTGAGG - Intergenic
1177190585 21:17846964-17846986 TTCTAATATAACCAGGGCTGGGG + Intergenic
1177485665 21:21752160-21752182 ATCACATAGAACAAGGGCTTAGG + Intergenic
1179159166 21:38877762-38877784 CTCAAAAGAAACGAGGGCTGTGG - Intergenic
1179450171 21:41463172-41463194 CCAAAATAGAGCTTGGGCTGTGG + Intergenic
1180535823 22:16392133-16392155 CCCAAATAGGACTAGGGGAGGGG + Intergenic
1181340938 22:22179329-22179351 GTCAAGTAAAACTAGGGCTCTGG + Intergenic
1182414707 22:30213743-30213765 CTCAGACAGAACTAAGGCTGCGG + Intergenic
950771792 3:15317514-15317536 TTGGAATAGAACTAGGGGTGCGG + Intronic
950936933 3:16848505-16848527 AACAAATAGAGCTAGGGCTTAGG - Intronic
959564052 3:107816087-107816109 CTAAAATAGATCTTTGGCTGAGG - Intergenic
960986766 3:123286032-123286054 CTCACAGAGAACTGGGGGTGAGG + Intronic
961324398 3:126101778-126101800 CTCAAACACTACCAGGGCTGGGG - Intergenic
962292053 3:134145505-134145527 CATAAATAGAACAAGGTCTGGGG + Intronic
962440204 3:135406417-135406439 CCAACATAGAACTCGGGCTGTGG - Intergenic
962994254 3:140609927-140609949 AGCAAAAAGAACTAAGGCTGAGG + Intergenic
963815345 3:149824782-149824804 CTCCAAAAGAACTAGGTCAGAGG + Intronic
965753982 3:172006558-172006580 CTCTGATAAAAGTAGGGCTGGGG + Intergenic
967048645 3:185761505-185761527 CTTAAATAGCACTTGGGATGGGG - Intronic
971354729 4:25885280-25885302 GGCAAACAGAACTAGGGATGGGG + Intronic
971753305 4:30678270-30678292 CCAACATAGAACTTGGGCTGTGG + Intergenic
972587440 4:40450708-40450730 CACAAATATCAATAGGGCTGAGG - Intronic
976674822 4:87692364-87692386 CCAACATAGAACTAGGGCCGTGG + Intergenic
976760156 4:88539820-88539842 CTCCAACAGAACTATAGCTGAGG + Intronic
977653265 4:99493028-99493050 CTCCAACAGAACTACAGCTGAGG + Intergenic
981515397 4:145603275-145603297 CTCAAATAGAAATTTGCCTGTGG + Intergenic
981989843 4:150904674-150904696 CTCAAAAAGAAGTAAGACTGAGG + Intronic
982787848 4:159557366-159557388 CACAAATAGAACAAAGGCAGAGG - Intergenic
983722231 4:170869802-170869824 GTTGTATAGAACTAGGGCTGGGG - Intergenic
984520204 4:180793110-180793132 GTCAAATAGAATCAGGGGTGAGG + Intergenic
984675147 4:182538861-182538883 CTAAAATAGAACAAGGTTTGGGG + Intronic
985603036 5:844682-844704 CCCAAAGGGAACTCGGGCTGAGG + Intronic
986452663 5:7881687-7881709 CTAAAATAGAACTAAGCCAGGGG - Intronic
986823018 5:11489378-11489400 GTCAAAAAGAAGTAGGTCTGTGG - Intronic
988808902 5:34765945-34765967 CCAACATAGAACTTGGGCTGTGG + Intronic
989048671 5:37296796-37296818 GTCAAATAAATCTAGGGGTGGGG - Intronic
990800215 5:59593701-59593723 CTCCAAGAGAACCAGTGCTGGGG + Intronic
992792457 5:80225791-80225813 TAGAAATAGAACTAGGGCTGTGG - Intronic
994039749 5:95245062-95245084 CTCCAATAGACCTACAGCTGAGG + Intronic
994609408 5:102018021-102018043 CTGAAATATAATTAGGGGTGTGG + Intergenic
995342386 5:111073689-111073711 CTCAAATTAAACTGGGGCTTTGG + Intronic
999654749 5:153800750-153800772 ACCAACTAGAACTAGGGCAGAGG + Intronic
999753546 5:154647739-154647761 CTAAAATGGCACTGGGGCTGTGG + Intergenic
1001224049 5:169928437-169928459 CTCTGGTAGAACTAAGGCTGGGG - Intronic
1001776734 5:174334526-174334548 CTGAAACAGGAATAGGGCTGTGG - Intergenic
1001872659 5:175170334-175170356 CTCAAAAATAACTACCGCTGTGG - Intergenic
1004665053 6:17741750-17741772 CTGAATTGGAACTATGGCTGGGG - Intergenic
1006847727 6:37074438-37074460 CTAATATAGAACCAGGGCCGAGG - Intergenic
1007513529 6:42393129-42393151 CTCAAACAGGTCAAGGGCTGTGG + Intronic
1009954064 6:70430541-70430563 CTCAAAAACAACTGTGGCTGTGG - Intronic
1014096222 6:117465138-117465160 CACAAGTAGAATTAGGGTTGGGG - Intronic
1014207303 6:118670009-118670031 CGCAAATAGAATTATGGATGTGG + Intronic
1016935315 6:149445460-149445482 CTCAAATAGGACCAGGGTAGAGG + Intergenic
1018894443 6:168003878-168003900 CTCACATAGAACTACGGGTCAGG - Intronic
1020657490 7:10944702-10944724 CTCAAAAAGAATTGTGGCTGTGG + Intergenic
1024265868 7:47606094-47606116 GTCAAATGGCATTAGGGCTGAGG + Intergenic
1028582583 7:92423001-92423023 CCCAAATAGAGCCAGGGGTGCGG + Intergenic
1036657822 8:10689095-10689117 ATCAAAAAGCACCAGGGCTGGGG + Intronic
1038932083 8:32204921-32204943 CCCTAATAGAACTACCGCTGTGG - Intronic
1045105470 8:98888370-98888392 ATCAAATAGCACAGGGGCTGAGG + Intronic
1045308647 8:100981346-100981368 CTCAAAGAAAAATAGTGCTGAGG + Intergenic
1045935270 8:107671485-107671507 GTAAAATAGAACATGGGCTGAGG - Intergenic
1046586579 8:116155610-116155632 CACAGACAGAAATAGGGCTGAGG - Intergenic
1051238456 9:15026071-15026093 CTCCAATAGAACTCCAGCTGAGG + Intergenic
1051464105 9:17356517-17356539 CTCTAAAAGTACTAGGGCTTGGG + Intronic
1055090408 9:72359508-72359530 CTCAAATAGAAATGTGCCTGTGG - Exonic
1055996968 9:82170637-82170659 CTCAAATAGAGTTAGGGGTGGGG + Intergenic
1058696800 9:107565683-107565705 AACAAACAAAACTAGGGCTGTGG + Intergenic
1190387916 X:49900854-49900876 CTCAAATAGGGCTGGGGCTTTGG + Intergenic
1191595938 X:62944158-62944180 CTAAAGTAGAGCTTGGGCTGTGG - Intergenic
1192365783 X:70471947-70471969 CACAATTAGAACTAGGTTTGAGG - Intronic
1193230856 X:79044493-79044515 ATCAAATATAACAAGGGCTGTGG - Intergenic
1193458781 X:81764564-81764586 CTCAAATATCACTAGCTCTGGGG - Intergenic
1195881986 X:109601989-109602011 CAAAAATAGACCTAGTGCTGAGG + Intergenic
1195992286 X:110694464-110694486 CACCAATAGAAATAGGGATGTGG + Intronic
1197118358 X:122860752-122860774 CTCAGATAGACCTGGGGCTATGG - Intergenic
1197904643 X:131412172-131412194 CTCTAACAGCACTCGGGCTGGGG + Intergenic
1198816885 X:140600842-140600864 TTCAATTAGAAGGAGGGCTGGGG - Intergenic
1200111981 X:153745011-153745033 CCCAAATAGGACTAGGGGAGGGG + Intergenic
1201234031 Y:11892970-11892992 CTCTAAAAGTACTAGGGCAGTGG + Intergenic
1201307272 Y:12561801-12561823 CTCTAAAAGTACTAGGGCAGTGG + Intergenic
1201452240 Y:14129100-14129122 CTAACATAGAGCTTGGGCTGTGG + Intergenic