ID: 1133472705

View in Genome Browser
Species Human (GRCh38)
Location 16:6091156-6091178
Sequence GTGCAAACCTACAGTTAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 495
Summary {0: 1, 1: 1, 2: 20, 3: 91, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133472705 Original CRISPR GTGCAAACCTACAGTTAGAT AGG (reversed) Intronic
900904058 1:5538248-5538270 GTACAAAGTTACAGTGAGATAGG + Intergenic
900904426 1:5542842-5542864 ATGCAAAATTACAGCTAGATGGG + Intergenic
905839756 1:41164992-41165014 GTAGAAACTTATAGTTAGATAGG - Intronic
906764997 1:48421080-48421102 GTACAAGATTACAGTTAGATAGG + Intronic
907024186 1:51099074-51099096 ATACAAACATACAGTTAGATAGG + Intergenic
907796009 1:57717991-57718013 GTACAAATTTACAGATAGATAGG + Intronic
907797859 1:57735351-57735373 CTTCAAACCTCCAGTGAGATAGG - Intronic
908012651 1:59796499-59796521 ATACAAACTTACAGCTAGATAGG + Intergenic
908258734 1:62322806-62322828 TTCCAAGCCTACAGTTAGAGAGG - Intergenic
908625428 1:66035430-66035452 GTACAAAGTTATAGTTAGATAGG - Intronic
909029258 1:70520177-70520199 TTTCAAAATTACAGTTAGATTGG + Intergenic
909346637 1:74596580-74596602 GTACAAAGTTACAGTTAGACAGG - Intronic
909430170 1:75578668-75578690 GTGCAAAGTTTCAGTTAGACAGG + Intronic
910198368 1:84669953-84669975 ATACAAACTTTCAGTTAGATAGG + Intronic
910721433 1:90290616-90290638 ATACAAACTTACAGCTAGATAGG + Intergenic
911465601 1:98249219-98249241 GTGCAAAGTTACAGTTAGACAGG + Intergenic
912205866 1:107508947-107508969 GTACAAACATACAGTTAGATAGG + Intergenic
915774632 1:158469381-158469403 GTACAAAATTTCAGTTAGATAGG - Intergenic
915908049 1:159893643-159893665 GTGCGCAGTTACAGTTAGATAGG + Intronic
916794724 1:168155107-168155129 ATACAAAGTTACAGTTAGATAGG - Intergenic
917446500 1:175109386-175109408 GTTTAAAAATACAGTTAGATAGG - Intronic
918502083 1:185208394-185208416 ATAAAAAGCTACAGTTAGATAGG + Intronic
918503289 1:185222883-185222905 GTACAAAGTTACAATTAGATAGG - Intronic
918676154 1:187288716-187288738 GTACAAAGTTCCAGTTAGATAGG - Intergenic
918835831 1:189464493-189464515 ATAGAAAACTACAGTTAGATAGG - Intergenic
919227338 1:194722924-194722946 ATGCATAATTACAGTTAGATAGG - Intergenic
919284213 1:195532588-195532610 GTACAAAAGTACAGTTAAATAGG + Intergenic
919622580 1:199879514-199879536 ATGCAAAATTACAGCTAGATAGG + Intergenic
920025734 1:202994137-202994159 GTACAAAGCTGTAGTTAGATAGG - Intergenic
920755299 1:208724885-208724907 GTACAAAAATACAGTTAGATAGG - Intergenic
921617752 1:217291351-217291373 GTACAAAATTACAGTTAGATAGG - Intergenic
924589076 1:245386363-245386385 GTACAAAGCCTCAGTTAGATAGG - Intronic
1063076985 10:2727153-2727175 GTACAAACATTCAGTTAGATGGG - Intergenic
1063119135 10:3092417-3092439 GTGCAAACATATGCTTAGATAGG + Intronic
1064701827 10:18029926-18029948 GTGGAAAGCTATAATTAGATAGG + Intronic
1065359383 10:24875357-24875379 GTGCAAAGTTACAGGCAGATAGG - Intronic
1065705323 10:28466905-28466927 GTACAAAGTTACAATTAGATAGG + Intergenic
1065764858 10:29019064-29019086 GTACAAAGTTACTGTTAGATTGG + Intergenic
1065986330 10:30956513-30956535 GTGCAAACCTACAGTCACATAGG - Intronic
1066047778 10:31608756-31608778 GTGGGTACATACAGTTAGATAGG - Intergenic
1066217025 10:33297845-33297867 CTGGGATCCTACAGTTAGATGGG + Intronic
1066621791 10:37362910-37362932 GTACAAAGTTATAGTTAGATAGG - Intronic
1067827228 10:49585624-49585646 GTACAAAGTTACAGTTAGATTGG + Intergenic
1068019500 10:51563192-51563214 GTACAAAATTACAGCTAGATAGG + Intronic
1068640993 10:59407671-59407693 GTGCAAAGTTACAGTTATATAGG - Intergenic
1069086888 10:64151071-64151093 GTGCAAAGTTCCAGTTAGACAGG - Intergenic
1069229280 10:65988071-65988093 GTACAAAAATACAGTTATATAGG + Intronic
1070003702 10:72401820-72401842 GTGCAAAGCTTCAGTTAGGCAGG - Intronic
1070049371 10:72872351-72872373 GTACAAAATTACAGTTAGATAGG - Intronic
1070098818 10:73365673-73365695 ATACAAAGTTACAGTTAGATAGG + Intergenic
1070170670 10:73930390-73930412 GGTCAAAGTTACAGTTAGATAGG + Intergenic
1070822961 10:79373528-79373550 GTACCAAATTACAGTTAGATAGG + Intergenic
1070855064 10:79601653-79601675 GTACAAAATTACAGCTAGATAGG + Intergenic
1071259361 10:83906051-83906073 GTTCAAGACTACAGTTAGCTAGG + Intergenic
1073665499 10:105528193-105528215 GTACAAAGTTTCAGTTAGATTGG + Intergenic
1073813123 10:107173259-107173281 GTACAAAGTTACAGTTATATAGG + Intergenic
1073997348 10:109330925-109330947 GTACAAAGCTACAGTTAGAGAGG - Intergenic
1074644133 10:115424846-115424868 ATACAAAGTTACAGTTAGATAGG + Intronic
1074911741 10:117916350-117916372 GTGCAAAGTTACAGTTAGATAGG + Intergenic
1075480058 10:122772541-122772563 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1079202896 11:18390603-18390625 GTGCAAAAATACAGTTAGATAGG - Intergenic
1079529474 11:21432962-21432984 ATGCAAAGTTACAGCTAGATGGG - Intronic
1079662502 11:23057538-23057560 GTACAAAGTTACAGTTACATAGG + Intergenic
1079827322 11:25213590-25213612 GAGCAAACCTTCAATTAGAGTGG - Intergenic
1079839524 11:25378851-25378873 GTTCAAAGCCACAGTTAAATAGG - Intergenic
1080242777 11:30146075-30146097 ATGCAAACTTTCAGTTAGCTAGG + Intergenic
1080985844 11:37464142-37464164 GTACAAAGTTACAGATAGATGGG + Intergenic
1081036490 11:38153247-38153269 GTACAAACATGCAGTTAGATAGG + Intergenic
1081253596 11:40865335-40865357 GTACAAAATTACAGTTAGATAGG + Intronic
1081286605 11:41278072-41278094 ATGCATAATTACAGTTAGATAGG + Intronic
1081902210 11:46638537-46638559 GTACAAGGCCACAGTTAGATAGG - Intronic
1082229976 11:49751844-49751866 GAACAAAATTACAGTTAGATAGG - Intergenic
1082666686 11:55983143-55983165 GTACAAACGTACAGTCAGATAGG + Intergenic
1082830793 11:57615574-57615596 GACCAAACCTAGAGTTAGACTGG + Intergenic
1083040956 11:59686450-59686472 GTGCAAGGTTTCAGTTAGATAGG + Intergenic
1083046884 11:59744676-59744698 GTGCAAAAATACAGTTAGATAGG + Intronic
1083520475 11:63306193-63306215 GTACAAAGCTACAGTTTGTTAGG - Intronic
1083982798 11:66187408-66187430 GTACAAAATTACAGCTAGATAGG - Intronic
1086620084 11:88877105-88877127 GAACAAAATTACAGTTAGATAGG + Intronic
1086749900 11:90478805-90478827 GTGCAAAGTTACAGTTAGATAGG + Intergenic
1086986261 11:93252520-93252542 ATACAAAAATACAGTTAGATAGG - Intergenic
1087503316 11:98987956-98987978 GTACAAACATTCAGTTAGTTAGG - Intergenic
1088389161 11:109294730-109294752 GTATAAGCATACAGTTAGATAGG + Intergenic
1088432250 11:109771560-109771582 GTACAAAGTTACAGTTAGACAGG - Intergenic
1088547781 11:110978298-110978320 GTACAAAGTTACAGTTAGATAGG + Intergenic
1089934376 11:122348607-122348629 GTGCAAAATTACAGATAGATAGG - Intergenic
1090384716 11:126350721-126350743 ATGCAAACTTTCAGTTGGATGGG - Intergenic
1090500935 11:127260211-127260233 ATGCAAAATTACAGTTAGATGGG + Intergenic
1092853862 12:12654765-12654787 GTACAAAACTCCAGTGAGATAGG - Intergenic
1093678226 12:21968866-21968888 ATACAAAGCTACAGGTAGATAGG + Intergenic
1093975559 12:25417207-25417229 ATGCAAAGTTACAGCTAGATGGG - Intronic
1094417057 12:30228354-30228376 GTCCAAAGTTTCAGTTAGATAGG - Intergenic
1095281532 12:40357029-40357051 GTACAAACATACAGTTAGATAGG - Intronic
1095499510 12:42821265-42821287 GTACAAAATTACAGTTAGATAGG - Intergenic
1096026708 12:48371044-48371066 ATGCAAAACTTCACTTAGATTGG + Intergenic
1097022567 12:56030824-56030846 GTACAAGATTACAGTTAGATGGG + Intronic
1097569203 12:61310540-61310562 ATACAAAACTACAGCTAGATAGG + Intergenic
1097836521 12:64278704-64278726 GTACAAAACTTCAGTTAGACAGG - Intronic
1097976059 12:65687680-65687702 GTACAAAGCTACAATTAAATAGG + Intergenic
1098531736 12:71549328-71549350 GTACAAAGCTTCAGTTAGACAGG + Intronic
1098569945 12:71977005-71977027 GTACAAAGTTGCAGTTAGATAGG + Intronic
1099007693 12:77253875-77253897 GTGCAAAATTACAGCTAGATAGG + Intergenic
1099196163 12:79618539-79618561 GTGCAAAGTTACAGTTAGATAGG - Intronic
1099259599 12:80361087-80361109 ATGCAAAATTTCAGTTAGATAGG - Intronic
1099282319 12:80666445-80666467 ATGCAAAATTACAGCTAGATAGG + Intronic
1099539430 12:83887858-83887880 GTACAAACTTGCAGTTATATGGG - Intergenic
1099749824 12:86758991-86759013 GTGCAAAGCTACAGTTAGGTAGG - Intronic
1099950753 12:89300170-89300192 GTACAAAGTTACAGTTAGATAGG + Intergenic
1099993775 12:89754369-89754391 GTACACATTTACAGTTAGATAGG + Intergenic
1102407936 12:112690401-112690423 GTGCCATGCTACAGTTAGCTGGG + Intronic
1103047367 12:117748327-117748349 GTACAAAGTTTCAGTTAGATAGG + Intronic
1105816975 13:24044934-24044956 GTACAAAGTTACAGTTAGATAGG + Intronic
1106437711 13:29738515-29738537 GTGCAAACGTATACATAGATAGG - Intergenic
1106644765 13:31620699-31620721 GTACAAAGGTACAATTAGATAGG - Intergenic
1107543859 13:41418315-41418337 GTACAAAGTTACAGTTAGACAGG + Intergenic
1107664685 13:42676652-42676674 GTACAAAAATATAGTTAGATAGG - Intergenic
1109015607 13:57008793-57008815 GTACAAATCTTCAGTTAGATAGG + Intergenic
1109031688 13:57198785-57198807 GTCCAAACCTATAGAAAGATAGG - Intergenic
1109673856 13:65646679-65646701 GGGTAAACCTACAGTTTAATAGG - Intergenic
1110724316 13:78802046-78802068 ATACAAAATTACAGTTAGATAGG - Intergenic
1110952206 13:81509722-81509744 GTACAAAGATACAATTAGATAGG + Intergenic
1111066359 13:83098197-83098219 GTGTAAAATTACAGTTAGACAGG - Intergenic
1111078500 13:83270513-83270535 GTACAAAGTTACAGTTAGACAGG + Intergenic
1111447392 13:88365412-88365434 GTACAAAGTTACAGTTAAATGGG - Intergenic
1111501443 13:89126115-89126137 GTACAAAGTTACAGTTAGAAAGG + Intergenic
1111876369 13:93902167-93902189 GTGCAAAGTTACAGTTAGGCTGG - Intronic
1115392595 14:32870031-32870053 GTACAAACATACAGTATGATAGG - Intergenic
1115695221 14:35890578-35890600 GTATAAACACACAGTTAGATAGG - Intronic
1115913915 14:38288066-38288088 ATGCAAAATTACAGCTAGATAGG + Intergenic
1115952996 14:38742517-38742539 GTACAAAGTTACAGTTAGACAGG + Intergenic
1116024640 14:39500255-39500277 GTACAAAGTTACAATTAGATAGG - Intergenic
1116316691 14:43405377-43405399 GTACAAAGTTACAGTTAGATAGG + Intergenic
1116803786 14:49470916-49470938 GTACAAAATTACAGCTAGATAGG + Intergenic
1117260115 14:54023751-54023773 ATACAAAAGTACAGTTAGATAGG - Intergenic
1117570916 14:57048466-57048488 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1117848621 14:59941905-59941927 GTACAAAATTACAGCTAGATAGG - Intronic
1118160145 14:63280414-63280436 GTACAAAGCTGCAGTTAGCTAGG + Intronic
1119811547 14:77524890-77524912 GTACAAACATATAGTTAGATAGG + Intronic
1120217700 14:81697780-81697802 GTACAAACTTGCAGTTACATAGG - Intergenic
1120308931 14:82805734-82805756 GTACAAAGTTACAGTTAGACAGG - Intergenic
1120416356 14:84222774-84222796 GTACAAAGTTACAGTTAGAAAGG + Intergenic
1122349740 14:101081947-101081969 GTACAAACCTACAGTAAGATAGG + Intergenic
1202928863 14_KI270725v1_random:21398-21420 GAGGAAACCTCCAGTTAGCTTGG - Intergenic
1123896068 15:24831579-24831601 GTACAAAATTTCAGTTAGATAGG - Intronic
1124049093 15:26178539-26178561 GTACAAAGCTCCAGTTAGACTGG + Intergenic
1124193466 15:27600041-27600063 GTACACAAGTACAGTTAGATGGG + Intergenic
1124385324 15:29203699-29203721 GTACAAAATTTCAGTTAGATTGG - Intronic
1125343020 15:38693189-38693211 GTACAAAACTGCAGTTACATAGG + Intergenic
1126204479 15:46029538-46029560 GTGCAAAGTTTCAGTTAGACAGG - Intergenic
1126305606 15:47252501-47252523 GTACAAAGTAACAGTTAGATAGG - Intronic
1126463906 15:48943211-48943233 GTCCAAACTTGCAGTTACATGGG - Intronic
1126836209 15:52668441-52668463 ATACAAAATTACAGTTAGATAGG + Intronic
1126974049 15:54154142-54154164 GTACAAAAATATAGTTAGATAGG - Intronic
1127729497 15:61786163-61786185 GTAGAAGGCTACAGTTAGATGGG - Intergenic
1127765515 15:62182468-62182490 ATGCAAAAATACAGTTAGATAGG + Intergenic
1130798646 15:87237503-87237525 GTACAAAGCTACAGTTAGACAGG - Intergenic
1133472705 16:6091156-6091178 GTGCAAACCTACAGTTAGATAGG - Intronic
1133541360 16:6757685-6757707 GTACAAACATATGGTTAGATAGG + Intronic
1135774920 16:25249174-25249196 GTACAAAATTTCAGTTAGATGGG + Intronic
1136743632 16:32562806-32562828 GTGCAAACATACAGTTTGAATGG - Intergenic
1137013737 16:35351228-35351250 TTACAAAGTTACAGTTAGATAGG + Intergenic
1137329240 16:47473972-47473994 GTACAAAGTTTCAGTTAGATAGG - Intronic
1137681647 16:50352030-50352052 GTACAGAATTACAGTTAGATGGG - Intronic
1139308400 16:66007445-66007467 GTGCAAACCTCCAGTTGTTTTGG + Intergenic
1141351043 16:83297115-83297137 GTACAAAGCTACAGTCACATAGG + Intronic
1141710613 16:85696851-85696873 GTGCAGAGCTACAGGTAGATGGG - Intronic
1203025967 16_KI270728v1_random:512423-512445 GTGCAAACATACAGTTTGAATGG + Intergenic
1203045754 16_KI270728v1_random:822008-822030 GTGCAAACATACAGTTTGAATGG - Intergenic
1143699128 17:8644841-8644863 GTACAAAATTGCAGTTAGATAGG - Intergenic
1144716292 17:17438004-17438026 GTACAAGCATACAGTTAGATAGG + Intergenic
1145358675 17:22190123-22190145 GTACAAAGTTACAGTTAGACAGG - Intergenic
1146470779 17:33122771-33122793 GTGCAAAGTTTCAGTTAGACAGG - Intronic
1147508620 17:41046227-41046249 GTACAAAGTTACAGGTAGATAGG + Intergenic
1148290954 17:46448794-46448816 GTACAAACGTACAGTAAGATAGG - Intergenic
1148313143 17:46666499-46666521 GTACAAACGTACAGTAAGATAGG - Intronic
1149145058 17:53480358-53480380 GTGCAAATTTACCATTAGATAGG - Intergenic
1150985251 17:70188920-70188942 GTACAAAGTTACAATTAGATAGG - Intergenic
1151081315 17:71332893-71332915 CTACAAACATACAGTTAGATAGG + Intergenic
1153380393 18:4432718-4432740 GTGCAAAGATTCAGTTAGACAGG - Intronic
1153989366 18:10382476-10382498 ATACAAACCTGCAGTTATATAGG - Intergenic
1154098144 18:11440075-11440097 ATACAAATGTACAGTTAGATAGG + Intergenic
1154308551 18:13248851-13248873 ATGCAAAATTACAGCTAGATAGG - Intronic
1155440655 18:25858454-25858476 GTACAAAATTACAGCTAGATAGG + Intergenic
1155598996 18:27522263-27522285 GTACAAAGTTTCAGTTAGATGGG - Intergenic
1156224802 18:35093805-35093827 GTACAAAGTTACAGTTAGGTAGG + Intronic
1156440188 18:37178157-37178179 GTACAAAGTTACAGTTAGATAGG - Intronic
1156812711 18:41272315-41272337 GTACAAAGCTACAGTTAAATAGG + Intergenic
1157300204 18:46473602-46473624 GTATAAACATGCAGTTAGATAGG + Intergenic
1159334700 18:67047282-67047304 GTACAAAGTCACAGTTAGATAGG - Intergenic
1159772745 18:72566687-72566709 GTACAATGTTACAGTTAGATAGG + Intronic
1162233679 19:9287871-9287893 GTGCAAAATTTCAGTTAGACAGG + Intergenic
1162862606 19:13518141-13518163 GTACAAAAATAGAGTTAGATAGG - Intronic
1163096415 19:15060807-15060829 GTACAAAAGTACAGTTAGGTAGG + Intergenic
1164463250 19:28466004-28466026 GTGCAAACTTGCAGTTATGTAGG + Intergenic
1164469291 19:28515774-28515796 GTACGAAGTTACAGTTAGATAGG - Intergenic
1165280203 19:34790641-34790663 GTGCAAAATTTCAGTTAGACAGG + Intergenic
1165605356 19:37098797-37098819 GTACAAAGTTATAGTTAGATAGG - Intronic
1168342523 19:55633566-55633588 TTGCAAACCTAAAGTTACAAGGG + Intergenic
1168495783 19:56848782-56848804 GTGCAAAATTTCGGTTAGATGGG - Intergenic
925410925 2:3639723-3639745 GACCCAACCTCCAGTTAGATGGG - Intronic
927734435 2:25506180-25506202 GTACAAACACAGAGTTAGATGGG + Intronic
928026882 2:27747631-27747653 GTGCAAAGTTTCAGTTAGACAGG - Intergenic
928481115 2:31684525-31684547 ATACAAAATTACAGTTAGATAGG + Intergenic
928724184 2:34151744-34151766 ATGCAAAATTTCAGTTAGATAGG + Intergenic
929356044 2:41025730-41025752 ATACAAAACTACAGCTAGATAGG + Intergenic
929883362 2:45856654-45856676 GTACAAAGTTACAGTTAGACAGG - Intronic
930061030 2:47288873-47288895 GTTCAAAAATACAGTTAGATAGG - Intergenic
930570681 2:53082272-53082294 GTACAAAGTTATAGTTAGATAGG + Intergenic
931363544 2:61598972-61598994 GTACAAAGCTACAGTTATGTGGG + Intergenic
931910466 2:66894206-66894228 GTACAAAGTTACAGTTATATAGG - Intergenic
933009468 2:77041027-77041049 GTACAAAGGTACAGTTAGATAGG - Intronic
933174655 2:79161439-79161461 GTACAAACATACAGCTAGATAGG + Intergenic
933419976 2:82032279-82032301 GTACAAAAATTCAGTTAGATAGG + Intergenic
933479397 2:82836250-82836272 ATACAAAATTACAGTTAGATGGG - Intergenic
934029929 2:88034751-88034773 GTACAAAGTTACAGGTAGATAGG - Intronic
934487172 2:94725923-94725945 ATACAAACTTACAGCTAGATAGG - Intergenic
934972151 2:98772591-98772613 ATGAAAACTTACAGTTAAATAGG - Intergenic
935029181 2:99305653-99305675 ATGCAAAATTACAGCTAGATAGG + Intronic
935236896 2:101146819-101146841 GTACAGAGTTACAGTTAGATAGG - Intronic
935393004 2:102573386-102573408 GTACAAGATTACAGTTAGATAGG - Intergenic
935818561 2:106870344-106870366 GTGAAAACTTCCAGTTAGCTCGG + Intronic
935998178 2:108796860-108796882 GTACAAAAATACAGTTAGATAGG + Intronic
936623000 2:114119539-114119561 GTCCAAAGTGACAGTTAGATAGG + Intergenic
936719125 2:115228456-115228478 GTACAAAAATATAGTTAGATAGG - Intronic
936829710 2:116628487-116628509 GTACAAAGTTACAGTTACATAGG + Intergenic
937504424 2:122520461-122520483 GTATAAAATTACAGTTAGATAGG + Intergenic
937567716 2:123315125-123315147 GTACAAAATTACAGTTAGACAGG + Intergenic
937580910 2:123486807-123486829 CTTCAAAGCTACAGTTAGAATGG + Intergenic
937752401 2:125492411-125492433 GTACAAGTTTACAGTTAGATTGG - Intergenic
938253906 2:129838365-129838387 GTACAAAGTTACAGTCAGATAGG + Intergenic
938564411 2:132505497-132505519 GTACAAACATAGAGTTAGATAGG - Intronic
939184936 2:138849273-138849295 GTACAAAAATACAGTTAGAGAGG + Intergenic
939276603 2:140005647-140005669 GTACAAACATATAGTTAGATAGG + Intergenic
939620891 2:144417724-144417746 GTACAAAACTACAGTTAGATAGG + Intronic
940620319 2:156104385-156104407 GTACAAAATTACAGTTAGACAGG + Intergenic
941129891 2:161634809-161634831 GCACCAAGCTACAGTTAGATAGG - Intronic
941516768 2:166490205-166490227 GTGCAAAATTTCAGTTAGAGAGG - Intronic
941707903 2:168679207-168679229 GTGTAAAGTTACAGTTAGATGGG + Intronic
941971574 2:171356519-171356541 GTACAAATATACAGTTAGAAGGG - Intronic
942190829 2:173468479-173468501 ATGCAAAATTTCAGTTAGATAGG - Intergenic
942863625 2:180646252-180646274 GTACAAAGTTTCAGTTAGATAGG - Intergenic
942986002 2:182143115-182143137 GTACAAAATTCCAGTTAGATAGG + Intronic
943138296 2:183943940-183943962 GTACAAACATACAGTTAGATGGG + Intergenic
943512937 2:188848642-188848664 GCACAAAGTTACAGTTAGATAGG + Intergenic
943874793 2:193051543-193051565 GTATAAACATACAGTTAAATAGG + Intergenic
944590362 2:201211340-201211362 GTACAAAGTTACAATTAGATAGG - Intronic
945768708 2:214013441-214013463 GTACAAAGTTACAATTAGATAGG - Intronic
946456950 2:219834437-219834459 GTACAAACATTCAGTTAGACAGG - Intergenic
948912816 2:241013195-241013217 GTGCAAACCTTCAGTCAGACAGG - Intronic
1169836085 20:9880795-9880817 GTACAAAATTACAGCTAGATAGG - Intergenic
1170266622 20:14473252-14473274 GTATAAAGTTACAGTTAGATAGG - Intronic
1170886620 20:20345144-20345166 GTACAAAAATACAGTTAGATAGG + Intronic
1170944156 20:20875411-20875433 GTACAAAATTCCAGTTAGATGGG - Intergenic
1171939284 20:31309115-31309137 GTACAAACTTTCGGTTAGATAGG - Intergenic
1171943970 20:31359327-31359349 GTATAAAACTACAGTTAGATAGG + Intergenic
1172534477 20:35662371-35662393 GTGCAAACCAAAAGGTATATGGG + Intronic
1174750394 20:53106192-53106214 GTACAAAATTACAGTTAGATAGG - Intronic
1175573880 20:60045783-60045805 GTACAAAGTTACAGTTAAATAGG + Intergenic
1176590885 21:8649985-8650007 GAGGAAACCTCCAGTTAGCTTGG - Intergenic
1177459312 21:21389534-21389556 GTACAAAATTGCAGTTAGATAGG - Intronic
1177951520 21:27543871-27543893 GTACAAAGTTATAGTTAGATAGG + Intergenic
1178010459 21:28279668-28279690 GTACAAAATTACAGTTAGATAGG + Intergenic
1178198524 21:30376253-30376275 GTGCAAAAATATAGTTAGATAGG - Intronic
1180273713 22:10627018-10627040 GAGGAAACCTCCAGTTAGCTTGG - Intergenic
1181912375 22:26249271-26249293 ATACAAACTTACAGCTAGATCGG - Intronic
1182166238 22:28176455-28176477 GTACAAAGTTACAATTAGATGGG + Intronic
1183451755 22:37899911-37899933 GTGCAAAATTTCAGTTAGATAGG - Intergenic
1184518249 22:44976421-44976443 GTACAAAGTTACAGTTAGGTGGG - Intronic
949149723 3:751969-751991 GTATAAACATGCAGTTAGATGGG - Intergenic
951041030 3:17989060-17989082 GTGTATAATTACAGTTAGATAGG - Intronic
951314579 3:21173297-21173319 GTACAAAATTACAGTTAGATAGG - Intergenic
952675048 3:36019120-36019142 ATGCAAAATTACAGCTAGATGGG - Intergenic
952675171 3:36021092-36021114 GTACAAAGATACAGTTAGGTAGG + Intergenic
953297324 3:41732990-41733012 GTACAAAATTACAGTTCGATAGG + Intronic
953306790 3:41838955-41838977 GTACAAACCTTCAGTTAGACAGG + Intronic
954569891 3:51631932-51631954 GTACAAAAATACAGTTAGACAGG - Intronic
954607124 3:51920734-51920756 GTGCAAAAATGCAGTTAGCTAGG - Intergenic
955061447 3:55495295-55495317 ATGCAAATTTTCAGTTAGATAGG - Intergenic
955108843 3:55927697-55927719 GTACAAAAATATAGTTAGATAGG - Intronic
955446487 3:59016418-59016440 ATACAAAACTACAGCTAGATAGG + Intronic
955563701 3:60221935-60221957 GTGCATACCCACATTTATATAGG - Intronic
958186434 3:90126204-90126226 GTACAAAGTTACAATTAGATAGG - Intergenic
958843623 3:99239026-99239048 GTATAAAGTTACAGTTAGATAGG - Intergenic
959160476 3:102718006-102718028 GTACAAACATACAGTTTGATAGG - Intergenic
959335607 3:105060872-105060894 GTACAAAGTTACAGTTAAATAGG + Intergenic
959363516 3:105426610-105426632 GTACAAATCTACAGTAAGATAGG - Intronic
959365028 3:105446895-105446917 GTACAAAGTCACAGTTAGATAGG + Intronic
959463980 3:106662946-106662968 ATACAAAGCTACAGTTAGGTAGG - Intergenic
959487080 3:106939191-106939213 GTACAAAAATACAATTAGATAGG - Intergenic
963279570 3:143369382-143369404 GTACAAAATTACAGCTAGATAGG + Intronic
963464055 3:145655262-145655284 GTACAAAGTTACAGTTAGACAGG - Intergenic
963608181 3:147431746-147431768 GTACAAAATTACAGCTAGATAGG - Intronic
963898171 3:150707862-150707884 GTACAAAGTTACAGTTAGATAGG - Intergenic
964491218 3:157238473-157238495 ATACAAAATTACAGTTAGATAGG - Intergenic
965151142 3:164976851-164976873 GTACAAACTTACAGTTAGATAGG - Intergenic
965152665 3:165000344-165000366 GCACAAAGTTACAGTTAGATAGG + Intronic
966100371 3:176261941-176261963 GTACAAAATTACAGTTACATAGG - Intergenic
966198931 3:177341421-177341443 ATGCAAAAGTATAGTTAGATAGG - Intergenic
966339330 3:178907597-178907619 GTACAAAGTTTCAGTTAGATAGG + Intergenic
966664497 3:182455704-182455726 GTACAAAATTACAGTTAGATGGG - Intergenic
967101838 3:186222079-186222101 TGGCAAACCTACAGCTAGACTGG + Intronic
967739583 3:192990185-192990207 GTGAAAAATTTCAGTTAGATAGG + Intergenic
968311801 3:197689906-197689928 GTTCAACCATACAGTTAGAAGGG - Intronic
972769970 4:42188599-42188621 GTACAAAAATATAGTTAGATAGG + Intergenic
973078354 4:45959514-45959536 GTACAAAGTTACAATTAGATAGG - Intergenic
974379700 4:61122912-61122934 GTGTAAAGCTACAGTTAAAAAGG - Intergenic
975068912 4:70107224-70107246 TTACAAAGGTACAGTTAGATAGG - Intergenic
975126312 4:70786278-70786300 GTACAAAGCTATAGTTAGATAGG + Intronic
975217792 4:71776538-71776560 GTGCAAAATTTCAGTTAGACAGG + Intronic
975288886 4:72652751-72652773 GTACAAAATTTCAGTTAGATAGG + Intergenic
975294287 4:72714517-72714539 ATACAAACTTTCAGTTAGATAGG - Intergenic
976702238 4:87983673-87983695 GTACAAAGTTACAGTTAGCTAGG - Intergenic
977035541 4:91947475-91947497 ATGCAAGCATAAAGTTAGATCGG - Intergenic
977379207 4:96249141-96249163 ATGCAAAGTTACAGTTAAATAGG + Intergenic
978005404 4:103609708-103609730 GTACAAATTTACAGTTCGATAGG - Intronic
978281040 4:107014530-107014552 GTACAAAGTTACAGTTAGATAGG + Intronic
978366282 4:107986355-107986377 GTGCAAAGTTACAGTTAGACAGG + Intergenic
978703163 4:111673745-111673767 GTACAAAGTTACAGTTCGATAGG + Intergenic
979061775 4:116071065-116071087 GTACAAAGTTATAGTTAGATTGG + Intergenic
979138498 4:117142019-117142041 GTACAAAGCTATGGTTAGATGGG + Intergenic
980015029 4:127639871-127639893 GTACAAAGTTACAGTTAGATAGG - Intronic
980892256 4:138828438-138828460 ATGCAAAATTTCAGTTAGATAGG + Intergenic
981465330 4:145063045-145063067 GTACAAAATTTCAGTTAGATAGG + Intronic
981710279 4:147702038-147702060 GTACAAAGCTACAATTAGATTGG + Intergenic
981896418 4:149806429-149806451 GTACAAAAATACAGTTACATAGG - Intergenic
982893230 4:160882544-160882566 GTACAATGTTACAGTTAGATAGG + Intergenic
982951218 4:161698399-161698421 ATGCAAAATTACAGTTAGATAGG + Intronic
983063718 4:163187167-163187189 ATGCACACATACAGTGAGATTGG + Intergenic
983283713 4:165712931-165712953 ATACACAACTACAGTTAGATGGG - Intergenic
983377419 4:166947969-166947991 GTACAAAGTTACAGTTAGTTGGG - Intronic
986653419 5:9987722-9987744 GTGCAAGGTTGCAGTTAGATAGG - Intergenic
987501275 5:18712613-18712635 GTTAAAAGTTACAGTTAGATAGG - Intergenic
987764127 5:22203202-22203224 GGTCAAAGTTACAGTTAGATAGG - Intronic
987898966 5:23985576-23985598 GTACAAAGTTTCAGTTAGATAGG + Intronic
988219227 5:28319844-28319866 ATGCTAACCTACAATTATATAGG + Intergenic
989000870 5:36758817-36758839 ATTCAAAGCTACAGTTAGACAGG + Intergenic
989210921 5:38858219-38858241 GCACAAACATGCAGTTAGATTGG - Intronic
989753947 5:44928836-44928858 GTACAAAGTTACAGTTAGATGGG - Intergenic
990752479 5:59031975-59031997 GTACAAAATTTCAGTTAGATTGG + Intronic
991243711 5:64487416-64487438 GTACAAAATTACAGTTAGATAGG - Intergenic
991644222 5:68785365-68785387 GTACAAAATTACAATTAGATTGG + Intergenic
991659681 5:68937617-68937639 GTACAAAGCTTCAGTTAGACAGG + Intergenic
991898857 5:71436286-71436308 GGTCAAAGTTACAGTTAGATAGG - Intergenic
992169924 5:74091560-74091582 GTACAAAATTACGGTTAGATAGG - Intergenic
993471944 5:88316998-88317020 ATACAAAATTACAGTTAGATAGG - Intergenic
993856278 5:93079838-93079860 GTACAAAGTTTCAGTTAGATTGG - Intergenic
994077059 5:95665311-95665333 GTACAAAATTACAATTAGATAGG - Intronic
994138436 5:96315755-96315777 GTGAAAACCTACAGATATTTAGG - Intergenic
994508986 5:100679401-100679423 GTGCAAAGTTACAATTAGATAGG - Intergenic
994647562 5:102490124-102490146 GTACTAAGTTACAGTTAGATAGG + Intronic
994814307 5:104564909-104564931 GTGCAAACCAAATGTTAGTTTGG + Intergenic
995285145 5:110379675-110379697 GTATAAACTTATAGTTAGATAGG - Intronic
995303669 5:110617310-110617332 GTGCAAAGTTTCAGTTAGACAGG + Intronic
996232707 5:121086449-121086471 GTACAAAAACACAGTTAGATAGG - Intergenic
996317814 5:122180661-122180683 TTGCAAATCTACGGTTACATAGG - Intergenic
996607276 5:125338298-125338320 GTACAAAGTTACAGTTAGGTAGG - Intergenic
997576060 5:134978194-134978216 GTACAAAGTTACAGTTAGATAGG + Intronic
1001064405 5:168524530-168524552 GTACAAACATACAGTAAGATAGG + Intergenic
1001858083 5:175030170-175030192 GTGCAAAAAGACAGTTACATAGG - Intergenic
1002588636 5:180270936-180270958 GTCCAAAATTTCAGTTAGATAGG + Intronic
1005178569 6:23076544-23076566 GTACAAAGTTACAGTTAAATAGG + Intergenic
1006068980 6:31483661-31483683 GTACAAAGATACAGTTAAATAGG - Intergenic
1006494543 6:34412681-34412703 GTACAAAGTTTCAGTTAGATAGG - Intronic
1007415427 6:41688742-41688764 GTCCAAACCTACAGCTAGCAGGG - Intronic
1007773704 6:44211496-44211518 GAGCAAAGCTATAGCTAGATAGG + Intergenic
1008254876 6:49285361-49285383 GTGCAAAGTTACATTTAGATAGG - Intergenic
1008801995 6:55379769-55379791 ATGCATAACTACAGTTAGATAGG - Intronic
1009650732 6:66474970-66474992 GTAAAAAGCTACAGTTAGGTAGG - Intergenic
1010321382 6:74514174-74514196 GTACAAAGTTACAGTTAGATAGG + Intergenic
1010321433 6:74514854-74514876 GTACAAAGTTACAGTTAGATAGG + Intergenic
1011446639 6:87448608-87448630 GGACAAAATTACAGTTAGATAGG - Intronic
1012025975 6:93991755-93991777 ATACAAAATTACAGTTAGATAGG + Intergenic
1012688962 6:102290397-102290419 GTACAAAGCTACAATTAGATAGG - Intergenic
1013821421 6:114157461-114157483 GTACAAAGTTTCAGTTAGATAGG + Intronic
1014888387 6:126810863-126810885 GGACAAAGTTACAGTTAGATAGG + Intergenic
1015369180 6:132431393-132431415 GTGCAATGTTACAGTTAGATAGG - Intergenic
1015675694 6:135745607-135745629 GTGCTAGCCTACAGAAAGATAGG - Intergenic
1015803226 6:137081493-137081515 TTGCAAAATTACAGTTAAATAGG - Intergenic
1016840657 6:148521170-148521192 GTGCAAACTAAAAGTTAGGTGGG - Intronic
1017196695 6:151709071-151709093 ATGCAAAACTTCAGTTAAATCGG - Intronic
1017427378 6:154336567-154336589 ATACAAACATACAGTTAGATAGG + Intronic
1020516737 7:9131087-9131109 GTACAAAATTTCAGTTAGATGGG - Intergenic
1021381218 7:19969010-19969032 GTACAAAATTCCAGTTAGATAGG - Intergenic
1021435545 7:20610334-20610356 ATGCAAAGTTGCAGTTAGATAGG + Intergenic
1021589381 7:22243882-22243904 GTACAAAATTTCAGTTAGATAGG - Intronic
1021684529 7:23170462-23170484 GTACAGAAATACAGTTAGATAGG + Intronic
1022209191 7:28192010-28192032 GTACAAAATTATAGTTAGATAGG + Intergenic
1023347059 7:39281403-39281425 GTACAAAGTTACAGTTAGATAGG - Intronic
1023450936 7:40284179-40284201 GGGCAAAGTTTCAGTTAGATGGG + Intronic
1023729892 7:43180947-43180969 TTACAAAGTTACAGTTAGATAGG - Intronic
1024050528 7:45619251-45619273 GTACAAAATTACAGGTAGATAGG + Intronic
1024291290 7:47806410-47806432 ATGCAAGACTACAGTTACATGGG + Intronic
1024783597 7:52880430-52880452 GTGGGAACCTTCATTTAGATGGG - Intergenic
1024923207 7:54582946-54582968 GTACAAACATATAATTAGATAGG + Intergenic
1027614975 7:80411031-80411053 ATACAAAGTTACAGTTAGATAGG - Intronic
1027913899 7:84289253-84289275 GTACAAAACTACAGTTAGATAGG + Intronic
1028668528 7:93373784-93373806 GTACAAAATTACAGTTAGATAGG + Intergenic
1029788386 7:102816584-102816606 GTGCAAACACACAGCTACATAGG - Intronic
1029793336 7:102868260-102868282 GTACAAAGTTACAGTGAGATAGG - Intronic
1029964890 7:104729474-104729496 GTACAAAGTTACAGTTAGATAGG - Intronic
1030038347 7:105427582-105427604 ATGCAAAATTACAGTTAGAAGGG + Intergenic
1030232130 7:107219712-107219734 GTACAAAGTTACAGTTAGACAGG + Intronic
1030501618 7:110366611-110366633 GTATAAAGCTACAGCTAGATAGG + Intergenic
1031174241 7:118329127-118329149 GTACAAACTTTCAGTTAGACTGG + Intergenic
1031449860 7:121901957-121901979 GTACAAAGTTACAGTCAGATAGG - Intronic
1031792842 7:126132067-126132089 GTACAAAATTATAGTTAGATAGG + Intergenic
1033469317 7:141630303-141630325 GTGCAAAGTTGCAGTTAGATAGG + Intronic
1033489849 7:141832819-141832841 GTACAAAAATACAGTTAGAATGG - Intergenic
1033634707 7:143201237-143201259 CTACAAAGTTACAGTTAGATAGG - Intergenic
1033702169 7:143850485-143850507 GTACAAAGGTTCAGTTAGATAGG + Intergenic
1035594602 8:846240-846262 GCACAAAGCTACAGTTAGATAGG - Intergenic
1037000508 8:13712623-13712645 GCACAAAAATACAGTTAGATAGG - Intergenic
1037127371 8:15367292-15367314 GTACAAAGCTTCTGTTAGATGGG + Intergenic
1037868613 8:22469381-22469403 GTACAAACATACATTAAGATAGG + Intronic
1038237801 8:25777837-25777859 ATGCACAACTACAGCTAGATAGG - Intergenic
1038289083 8:26232662-26232684 GTACAAACGTACAGTTAAATAGG - Intergenic
1040922642 8:52640288-52640310 GTACAAAGCTACAGCCAGATAGG + Intronic
1041315675 8:56559787-56559809 GTGCAAAGTTTCAGTTACATGGG - Intergenic
1041348124 8:56922540-56922562 TTGCAAACCTAGTGTTAGAAAGG + Intergenic
1041882817 8:62772011-62772033 GTACAAAAATATAGTTAGATAGG - Intronic
1042949932 8:74190571-74190593 GTACAAAGTTACAGTTAGATAGG - Intergenic
1044143429 8:88683580-88683602 GTACAAATATACAGTCAGATAGG - Intergenic
1044160537 8:88909024-88909046 ATACAAAGTTACAGTTAGATAGG + Intergenic
1044218690 8:89644348-89644370 ATACAAAACTACAGCTAGATAGG + Intergenic
1044359494 8:91264990-91265012 GCACAAAGTTACAGTTAGATAGG - Intronic
1045543692 8:103109581-103109603 GTGCAAATATGCAGTTAGATAGG + Intergenic
1046544196 8:115627382-115627404 GTGCAAATGTAAAGTCAGATTGG - Intronic
1048047684 8:130788518-130788540 GTACAAACTTACAGTTAGATAGG + Intronic
1049161009 8:141097611-141097633 GTACAAACATACAGTTAGATAGG - Intergenic
1050207472 9:3212457-3212479 GTACAAAGTTACAGTTTGATAGG + Intergenic
1052097237 9:24397787-24397809 ATACAAAATTACAGTTAGATAGG - Intergenic
1052255471 9:26451072-26451094 ATACAAAAATACAGTTAGATAGG - Intergenic
1052259763 9:26500561-26500583 ATGCAAAATTTCAGTTAGATAGG + Intergenic
1053670629 9:40358428-40358450 ATACAAACTTACAGCTAGATAGG + Intergenic
1053920418 9:42984773-42984795 ATACAAACTTACAGCTAGATAGG + Intergenic
1054381750 9:64498491-64498513 ATACAAACTTACAGCTAGATAGG + Intergenic
1054513984 9:66017872-66017894 ATACAAACTTACAGCTAGATAGG - Intergenic
1054726845 9:68660979-68661001 ATGTAAAATTACAGTTAGATAGG + Intergenic
1054833866 9:69655789-69655811 GAACAAAATTACAGTTAGATAGG + Intronic
1055879172 9:80978228-80978250 GTACAAAATTACAGTTAGGTAGG - Intergenic
1057462580 9:95276751-95276773 GTACAAAGTTACAGTTAGACAGG + Intronic
1057992898 9:99790777-99790799 GTACAAAAATATAGTTAGATAGG - Intergenic
1058241910 9:102573309-102573331 GTACAAAGTTACAGTTAGATAGG + Intergenic
1058313075 9:103530417-103530439 GTACAAACCTTCAGTTAGATAGG + Intergenic
1058382826 9:104396655-104396677 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1059509541 9:114831312-114831334 GTACAAAGTTACAATTAGATAGG - Intergenic
1059845769 9:118274898-118274920 GTGCAAACATACAGTTTGAATGG + Intergenic
1060595742 9:124847590-124847612 GTACAAAAATACACTTAGATAGG - Intergenic
1203620899 Un_KI270749v1:128709-128731 GAGGAAACCTCCAGTTAGCTTGG - Intergenic
1185785119 X:2884240-2884262 GTACAAAATTACAGCTAGATAGG + Intergenic
1186032178 X:5380192-5380214 ATACAAACTTACAGCTAGATAGG + Intergenic
1186934761 X:14436284-14436306 GTACAAAGTTACAATTAGATAGG - Intergenic
1187596579 X:20779018-20779040 GTACAAACATACAGTTAGAAAGG + Intergenic
1187894863 X:23971266-23971288 GCACAAACATACAATTAGATAGG - Intergenic
1188121468 X:26313809-26313831 GTACAAAGCTACAATTAAATAGG - Intergenic
1188248555 X:27863384-27863406 GTACAAAATTTCAGTTAGATGGG + Intergenic
1188447835 X:30275030-30275052 ATACAAAGTTACAGTTAGATAGG + Intergenic
1189163053 X:38830839-38830861 GTACAAAATTACAGTCAGATAGG + Intergenic
1189407417 X:40737249-40737271 GTACAAAGTTTCAGTTAGATAGG - Intergenic
1189422436 X:40868142-40868164 GGACAAAGTTACAGTTAGATAGG - Intergenic
1189849232 X:45162527-45162549 GTGCAAACCCACAATTATATTGG + Intronic
1189862077 X:45283017-45283039 GTACAAAACTATAGTTAGATAGG + Intergenic
1189876596 X:45442561-45442583 GTACAAAGCTACAATTATATAGG - Intergenic
1190133801 X:47775500-47775522 ATACAAACATACAGTTAGATAGG + Intergenic
1190154724 X:47980336-47980358 GTGCAAAGATATAGTTAGATAGG + Intronic
1190258651 X:48784174-48784196 GTACAAAGCTACAGTTAGATAGG + Intergenic
1190574602 X:51820859-51820881 GTACAAAATTACAGTTAAATAGG - Intronic
1190905930 X:54728215-54728237 GTACAAATTTACAGTTAGACAGG + Intergenic
1190957834 X:55213369-55213391 CTACAAAATTACAGTTAGATAGG - Intronic
1191708849 X:64125584-64125606 GTACATAGCTTCAGTTAGATAGG + Intergenic
1193143251 X:78051720-78051742 GTACAAAGATACAATTAGATAGG - Intergenic
1193302970 X:79914642-79914664 ATACAAAACTACAGTTAGATAGG - Intergenic
1193304824 X:79936177-79936199 ATACAAAGCTACAGTTAGATAGG - Intergenic
1193344961 X:80394970-80394992 GTCCAAAGTTACAATTAGATAGG - Intronic
1193443751 X:81574569-81574591 GTATAAACATACAGTTAGAGAGG + Intergenic
1193792569 X:85833383-85833405 GTACAAAGTTTCAGTTAGATAGG + Intergenic
1193847049 X:86485412-86485434 GTACAAACCTACAGTTAGATAGG + Intronic
1194234377 X:91364132-91364154 GTACAAACATACAGTTAGATAGG - Intergenic
1194855951 X:98928810-98928832 ATACAAAATTACAGTTAGATAGG + Intergenic
1194906345 X:99580925-99580947 GTAAAAAAATACAGTTAGATAGG - Intergenic
1195602170 X:106762212-106762234 GTACAAACTTACAGTTAGGCAGG - Intronic
1195612209 X:106880576-106880598 GTACAAAGTTACAGTTAGATAGG + Intronic
1195712233 X:107782572-107782594 GTTCAAAGCTTCAGTTACATGGG - Intronic
1195761587 X:108252083-108252105 GTATAAACTTATAGTTAGATAGG - Intronic
1196575231 X:117309342-117309364 GTAAAAACCTACAGTTAGATAGG + Intergenic
1196642711 X:118081693-118081715 GTACCAACATACAGTTAAATAGG - Intronic
1196981962 X:121224264-121224286 GTACAAAAATACAGTTAGATAGG - Intergenic
1197303595 X:124812035-124812057 ATAAAAACTTACAGTTAGATAGG + Intronic
1197390156 X:125853432-125853454 GTACAAAGGTACAGTTAGAAAGG - Intergenic
1197494763 X:127164121-127164143 GGACAAAGTTACAGTTAGATAGG + Intergenic
1197847696 X:130820841-130820863 GTGCAAAATTTCAGTTAGAAAGG + Intronic
1198632827 X:138660703-138660725 GTACAAAAATATAGTTAGATAGG - Intronic
1198993986 X:142551792-142551814 GTACAAGGCTACAGTTACATAGG + Intergenic
1199102736 X:143823420-143823442 ATGCAAAATTACAGCTAGATAGG + Intergenic
1199749878 X:150805353-150805375 GTGCAAAGTTTCAGTTAGACAGG + Intronic