ID: 1133474207

View in Genome Browser
Species Human (GRCh38)
Location 16:6104094-6104116
Sequence CTATGATGTCCCTAATTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 94}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133474207 Original CRISPR CTATGATGTCCCTAATTAGA AGG (reversed) Intronic
908537110 1:65088681-65088703 TGAAGATGTTCCTAATTAGAGGG + Intergenic
910955377 1:92697674-92697696 CTGTGATCTACCTAATTTGAAGG + Intronic
912760895 1:112366356-112366378 CTATGAAGTCCCTACAGAGAAGG + Intergenic
920272718 1:204778359-204778381 CTATGATTTTCCCAATTATATGG + Intergenic
1066401752 10:35083574-35083596 CTATGATGTCAGAAAATAGAAGG + Intronic
1070066796 10:73043186-73043208 TTAAGATGTTCCTAATGAGATGG + Intronic
1071208702 10:83313410-83313432 CTATGCTGTCCCTTATCAGACGG + Intergenic
1072107402 10:92287837-92287859 GTATGAGGTTCCTTATTAGAGGG - Intronic
1072159646 10:92754274-92754296 CTTTGATGTCCCAAATTACCTGG + Intergenic
1075267951 10:121021328-121021350 CTATGATGATCATAATTAAAAGG - Intergenic
1078788229 11:14517742-14517764 TTATAATGTCTCTATTTAGAGGG - Exonic
1085449237 11:76622115-76622137 CTAGGATGTGACTAATTAGATGG + Intergenic
1086585997 11:88451887-88451909 CTAAGATTTCCCTACTCAGAAGG + Intergenic
1091554131 12:1559270-1559292 ATATTATGTCCCTAATAAAAAGG - Intronic
1095787389 12:46124478-46124500 CGATCCTGTGCCTAATTAGAAGG - Intergenic
1096787467 12:54025695-54025717 TTATGACGTCCCTAAACAGAGGG - Intronic
1099008027 12:77258920-77258942 TTAAGATGTCACTAATTACAAGG - Intergenic
1108548437 13:51519659-51519681 CTATGATGTCTCTTCTTAGAAGG - Intergenic
1109084866 13:57957162-57957184 CTCTGACCTCCCAAATTAGAAGG - Intergenic
1110885128 13:80623397-80623419 CTATGATCTCCGTCAGTAGAGGG - Intergenic
1114567233 14:23641654-23641676 CCCTGAGGTCCCTAATAAGAAGG - Intronic
1114767885 14:25395124-25395146 CTAGCATGTCCCTAATCAGGTGG + Intergenic
1114970360 14:28019256-28019278 CTAAGATGTCACTAATTCTAAGG - Intergenic
1116810214 14:49532733-49532755 CTATGTTGTCCCTTATTTGTGGG + Intergenic
1117567854 14:57014607-57014629 CTATCATGTCCCTACTGACATGG - Intergenic
1119777021 14:77255720-77255742 CTGTCATTCCCCTAATTAGAAGG - Intronic
1123971909 15:25515348-25515370 GTTTGATGTACCTAATTACAAGG - Intergenic
1125342025 15:38684658-38684680 CTATGATGTGCTTAGTGAGATGG + Intergenic
1126264127 15:46732750-46732772 CTATGAAGTCCCTAATTTAAAGG + Intergenic
1128606859 15:69043000-69043022 GTCTGATGTCCCCCATTAGAAGG + Intronic
1133474207 16:6104094-6104116 CTATGATGTCCCTAATTAGAAGG - Intronic
1134494013 16:14717829-14717851 CCATGATGTCCCTGCTTAGGAGG - Intronic
1134499393 16:14756953-14756975 CCATGATGTCCCTGCTTAGGAGG - Intronic
1134525944 16:14943580-14943602 CCATGATGTCCCTGCTTAGGAGG - Intronic
1134546463 16:15112782-15112804 CCATGATGTCCCTGCTTAGGAGG + Intronic
1134581178 16:15372066-15372088 CCATGATGTCCCTGCTTAGGAGG + Intronic
1134713523 16:16342068-16342090 CCATGATGTCCCTGCTTAGGAGG - Intergenic
1134721393 16:16385426-16385448 CCATGATGTCCCTGCTTAGGAGG - Intronic
1134946033 16:18326458-18326480 CCATGATGTCCCTGCTTAGGAGG + Intronic
1134953296 16:18366602-18366624 CCATGATGTCCCTGCTTAGGAGG + Intergenic
1136151255 16:28351217-28351239 CCATGATGTCCCTGCTTAGGAGG + Intronic
1136167487 16:28465057-28465079 CCATGATGTCCCTGCTTAGGAGG + Intronic
1136195490 16:28649961-28649983 CCATGATGTCCCTGCTTAGGAGG - Intronic
1136211828 16:28764077-28764099 CCATGATGTCCCTGCTTAGGAGG - Intronic
1136256548 16:29044023-29044045 CCATGATGTCCCTGCTTAGGAGG - Intronic
1136308788 16:29392282-29392304 CCATGATGTCCCTGCTTAGGAGG + Intronic
1136322205 16:29493813-29493835 CCATGATGTCCCTGCTTAGGAGG + Intronic
1136436884 16:30233785-30233807 CCATGATGTCCCTGCTTAGGAGG + Intronic
1139856492 16:69984717-69984739 CCATGATGTCCCTGCTTAGGAGG + Intergenic
1140366239 16:74383346-74383368 CCATGATGTCCCTGCTTAGGAGG - Intronic
1149813619 17:59702412-59702434 TAATGCTGTCGCTAATTAGACGG + Intronic
1150305509 17:64081601-64081623 CTTCAATGTACCTAATTAGATGG + Intronic
1153073210 18:1131131-1131153 CTATGATGTCCCTTCTGAGAGGG + Intergenic
1154117966 18:11627980-11628002 CCATGATGTCCCTGCTTAGGAGG + Intergenic
1155704340 18:28789650-28789672 CTATGATGTCCCTCAGAGGAGGG - Intergenic
1156560005 18:38113929-38113951 CTATGATGTCCTTCATTGAATGG - Intergenic
1162483267 19:10942099-10942121 CCAAGATGTCACTAAGTAGATGG - Intergenic
927531524 2:23808661-23808683 CTATGATGTGATTAATTATATGG - Intronic
929206305 2:39298126-39298148 ATATGAAGTCCCTAATTTTAAGG - Intronic
930422203 2:51167405-51167427 CTATGATCTCCTTGAATAGAGGG + Intergenic
931584853 2:63814202-63814224 CTTTGATCTCTGTAATTAGAGGG - Intronic
931603897 2:64032397-64032419 CTATGATGTTACTAGTTAGCAGG + Intergenic
932179032 2:69629076-69629098 CTATAATGTGCCTCTTTAGAGGG + Intronic
934143131 2:89067968-89067990 CTATGATTTACCTAATTCCAAGG + Intergenic
934226112 2:90132587-90132609 CTATGATTTACCTAATTCCAAGG - Intergenic
939885906 2:147681623-147681645 CTATTATGTCCTTTATTCGAGGG - Intergenic
940534343 2:154920458-154920480 GTATGATGTCCCCAAGTAGATGG - Intergenic
944138160 2:196423627-196423649 CTATGTTGTCACAAATGAGAGGG + Intronic
1169980468 20:11379001-11379023 ATATGATCTCCTTAATTTGATGG - Intergenic
1171018226 20:21561068-21561090 TTCTGATGTTGCTAATTAGAAGG + Intergenic
1173470870 20:43322464-43322486 CTATGATGCTCCAAATCAGAGGG + Intergenic
1173573166 20:44091319-44091341 CAATGTTGTCCCTAAGTGGATGG - Intergenic
1178689281 21:34737904-34737926 CTTTTATCTCCATAATTAGAGGG - Intergenic
951090507 3:18567915-18567937 CTAGGATGCCCCCAATTACAAGG - Intergenic
952224664 3:31363009-31363031 CAAAGATGGCTCTAATTAGAGGG + Intergenic
956167372 3:66406738-66406760 CCTTGAAGTCCCTAATTAGATGG - Intronic
956327062 3:68065117-68065139 TTCTGATCTCCCTAATTTGAGGG - Intronic
957433351 3:80142884-80142906 CTATGTTGTTCCTAATGATAGGG + Intergenic
958541784 3:95486353-95486375 CGATGATGTAGCTAATTAGAAGG - Intergenic
958547360 3:95571796-95571818 CTATGCAGTCCCTATTTAAATGG + Intergenic
959988024 3:112598734-112598756 CAAATATGTCCCTTATTAGAGGG + Intergenic
984412975 4:179419013-179419035 CCATGATGACTCTAATTAGATGG + Intergenic
985324619 4:188754205-188754227 CTATAATGTCCCTTCTTATAAGG + Intergenic
993567615 5:89494111-89494133 CTATGATGTCACTAAGTAATAGG - Intergenic
995090951 5:108176167-108176189 CTAGGATGTCCCTAAATCCATGG + Intronic
1005598635 6:27404635-27404657 CTATGATGTCACTAGTTAATAGG - Intergenic
1014716401 6:124869365-124869387 CTAAGATGTCCTTCAGTAGATGG + Intergenic
1015680688 6:135804726-135804748 CTCTGATGTCCCTTTTTATAAGG + Intergenic
1016256109 6:142107516-142107538 CTCTGATGTCACTACTCAGAGGG - Intergenic
1016424553 6:143920582-143920604 CTGTGATGTCACTAAGTAAAAGG + Intronic
1022957277 7:35392694-35392716 CTACGATGTCCCTAACTGAAGGG + Intergenic
1027021533 7:74818419-74818441 CTATTATGTACTGAATTAGAAGG + Intronic
1031662726 7:124446304-124446326 CTAGAATGTCCAAAATTAGAAGG - Intergenic
1033301857 7:140193521-140193543 CTATGATGTCCCTAGCTATGGGG - Intergenic
1033992175 7:147301922-147301944 CTAACTTGTCACTAATTAGATGG - Intronic
1038365740 8:26931746-26931768 CTCTGATGTCCTTACTGAGAGGG - Intergenic
1039596924 8:38798681-38798703 CTATGATGTACCTAAGAGGATGG + Intronic
1043078235 8:75729681-75729703 CTATGATTTCCCTAACATGAAGG - Intergenic
1046403212 8:113735152-113735174 CTATGATGTCTCTCCTTATAAGG + Intergenic
1048025978 8:130587026-130587048 CTATTATGACCCTAATGTGAAGG + Intergenic
1052761388 9:32595791-32595813 CTATGCTTTCCCTAACTAAATGG - Intergenic
1058539556 9:105997403-105997425 CTATGATGTCCTGACCTAGAAGG - Intergenic
1186472657 X:9833513-9833535 TTATGAGGTCCCTAATTAGGAGG - Intronic
1187128507 X:16477445-16477467 CTATGACGTTCCTAATAATAAGG - Intergenic
1189624279 X:42878975-42878997 CTAAGATGACCCCAATTTGAGGG - Intergenic