ID: 1133476373

View in Genome Browser
Species Human (GRCh38)
Location 16:6125653-6125675
Sequence CTGACTGCAGTCAGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 0, 2: 4, 3: 23, 4: 298}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133476373_1133476376 13 Left 1133476373 16:6125653-6125675 CCTTGGGAGCTGACTGCAGTCAG 0: 1
1: 0
2: 4
3: 23
4: 298
Right 1133476376 16:6125689-6125711 CTAACCTGGATTGATGGTTCTGG 0: 1
1: 0
2: 0
3: 3
4: 81
1133476373_1133476378 22 Left 1133476373 16:6125653-6125675 CCTTGGGAGCTGACTGCAGTCAG 0: 1
1: 0
2: 4
3: 23
4: 298
Right 1133476378 16:6125698-6125720 ATTGATGGTTCTGGTTGATCAGG 0: 1
1: 0
2: 0
3: 12
4: 126
1133476373_1133476374 -1 Left 1133476373 16:6125653-6125675 CCTTGGGAGCTGACTGCAGTCAG 0: 1
1: 0
2: 4
3: 23
4: 298
Right 1133476374 16:6125675-6125697 GCAGAAATGCGTGTCTAACCTGG 0: 1
1: 0
2: 1
3: 3
4: 48
1133476373_1133476375 7 Left 1133476373 16:6125653-6125675 CCTTGGGAGCTGACTGCAGTCAG 0: 1
1: 0
2: 4
3: 23
4: 298
Right 1133476375 16:6125683-6125705 GCGTGTCTAACCTGGATTGATGG 0: 1
1: 0
2: 1
3: 5
4: 54

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133476373 Original CRISPR CTGACTGCAGTCAGCTCCCA AGG (reversed) Intronic