ID: 1133477554

View in Genome Browser
Species Human (GRCh38)
Location 16:6138167-6138189
Sequence ATGACTTAGGGCCCATTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133477551_1133477554 30 Left 1133477551 16:6138114-6138136 CCTGCATTTGAATTCTAGTTCTA 0: 1
1: 2
2: 7
3: 108
4: 637
Right 1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133477554 Original CRISPR ATGACTTAGGGCCCATTTGA TGG Intronic
901499780 1:9644861-9644883 AATACTTTGGCCCCATTTGATGG + Intergenic
903287692 1:22286856-22286878 AGGGCTTGGGGTCCATTTGAAGG + Intergenic
906067421 1:42992071-42992093 ATGACTAAAGGCCTATTTTACGG - Intergenic
910614324 1:89180391-89180413 TTGACTGAGGGCCCTTTTGCAGG - Intergenic
911250849 1:95574886-95574908 ATGAATTAGGGTCCATCTGTTGG + Intergenic
911611572 1:99964142-99964164 TTGACTTAGGGGCCAAGTGATGG - Intergenic
911864344 1:102997501-102997523 ATGTCTTAGTGCCCCTTTGAAGG - Intronic
915449488 1:155994726-155994748 ATGGCACAGGGCCCATTTGTAGG - Intronic
916428807 1:164708004-164708026 ATGACTTACAGCAGATTTGATGG + Intronic
920810687 1:209282703-209282725 ATTAATTAGGGCCTAATTGAAGG + Intergenic
1064465545 10:15576557-15576579 ATGTCATAGGGCCCTTTTAAAGG + Intronic
1064603676 10:17017074-17017096 ATGGCTTAGGACACATTTCAAGG + Intronic
1067044198 10:42975245-42975267 GTGACTGATGGCCCATTTGGTGG - Intergenic
1068072286 10:52210124-52210146 ATGAACTAGGGCCCATAAGATGG + Intronic
1068500206 10:57834451-57834473 ATGACTTAGGATGCATTTCAAGG - Intergenic
1068589508 10:58839168-58839190 ATTGCTGAGGTCCCATTTGATGG - Intergenic
1069105493 10:64378562-64378584 ATGACTGAGAGGCCACTTGAAGG + Intergenic
1070992177 10:80742083-80742105 ATCCTTTAGGGCCCACTTGAAGG - Intergenic
1074043821 10:109818543-109818565 AGGACTTATGACCCATTTGAAGG - Intergenic
1083600490 11:63944518-63944540 ATGACTGAGGGTCCTTATGAGGG - Intronic
1084947128 11:72644122-72644144 GTCATTTAGGGGCCATTTGAAGG + Intronic
1086855156 11:91857201-91857223 GTGAGTTAGGGCCCATTTGGGGG - Intergenic
1088569407 11:111207095-111207117 AAGTCCAAGGGCCCATTTGAAGG - Intergenic
1092328504 12:7560391-7560413 ATGAGATAGGGACCCTTTGAAGG - Intergenic
1094006346 12:25756208-25756230 ATGTCTTAGGTGCCATTTAATGG - Intergenic
1098013509 12:66080011-66080033 ATGACTGAGGTCGCATTTGAGGG - Intergenic
1104216796 12:126741717-126741739 ATGACAGAGGGCCTCTTTGAGGG + Intergenic
1107342052 13:39417822-39417844 CAGACACAGGGCCCATTTGATGG - Intronic
1108576683 13:51797109-51797131 ATGACTGAGGGTCCTTTTGGGGG + Intronic
1108848534 13:54702164-54702186 ATGACTTAGGATGCATTTCAAGG - Intergenic
1110164123 13:72417189-72417211 ATGACCTAGAGCCTATTTTATGG - Intergenic
1114261575 14:21040589-21040611 AAGACTTACGGACCATTTGAAGG - Intronic
1119876819 14:78066886-78066908 AGGACCTAGGGCCTACTTGAGGG - Intergenic
1122926078 14:104901705-104901727 ATGACTTACGGCCCAGTATATGG + Intergenic
1123789696 15:23708621-23708643 TTGATATAGGGCCCATTAGAAGG + Intergenic
1124590617 15:31050159-31050181 ATGACTCAGGGCCCCTCTGTGGG + Intronic
1126532870 15:49730920-49730942 ATGAATGAGAGCCCATTTGGGGG + Intergenic
1128761403 15:70218413-70218435 ATGATTGAAGGCCCATTTGCAGG + Intergenic
1130563283 15:84975124-84975146 GTGACTTAGGTTCCATATGAGGG + Intergenic
1131518063 15:93092530-93092552 ATCACTGATGGCCCATCTGATGG + Intergenic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1134029861 16:10983337-10983359 ATGACTCAGGCCCCAGGTGAGGG + Intronic
1139161658 16:64517445-64517467 AGGCCCTAGGGCCCACTTGAGGG + Intergenic
1143006971 17:3843357-3843379 ATGCCTGAGGGCCCAGCTGAGGG - Intronic
1158563370 18:58533855-58533877 AGGGGTTAGGACCCATTTGATGG + Intronic
1161711518 19:5851272-5851294 ATGAATCAGGGCCCATAGGATGG + Intronic
1164834108 19:31346257-31346279 AGGAATTAGGGCCCTTTTAATGG - Intronic
932229331 2:70069608-70069630 ATTATTTGTGGCCCATTTGAAGG - Intergenic
933185365 2:79272071-79272093 ATGCCTTAGGTCCTATTTTAAGG + Intronic
937998592 2:127713977-127713999 CTGACATCGGGCCCATGTGATGG + Exonic
938604099 2:132874426-132874448 ATGACGTAGGGCCCAGCTGTAGG + Intronic
939567754 2:143804758-143804780 ATTACTTTGGGCCCATGTAAAGG - Intergenic
942177390 2:173346973-173346995 GAGACTTAGGGCTCATTTGTAGG - Intergenic
943268639 2:185770541-185770563 ATGACTTTGTGCCCACTTCATGG - Intronic
943860076 2:192850233-192850255 AACACTTAGAGCCCATTTTAGGG - Intergenic
945683283 2:212938704-212938726 TTGGCTTAGGGCCCATTTGTAGG - Intergenic
945683370 2:212939446-212939468 TTGGCTTAGGGCTCATTTGTAGG + Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
1170464191 20:16608074-16608096 ATGACTTAGGTCTCCTCTGAGGG + Intergenic
1179316904 21:40252036-40252058 ATGGCTTAGGTCTCATCTGAAGG - Intronic
950439410 3:13000285-13000307 ATGAATTTTTGCCCATTTGATGG - Intronic
953722069 3:45364861-45364883 ATGACTAAATGCCCAATTGATGG + Intergenic
957392051 3:79588045-79588067 ATTACTCAGGGCCCATTTTGAGG - Intronic
966178351 3:177164283-177164305 ACAATTTAGGGGCCATTTGAAGG - Intronic
974187197 4:58459850-58459872 ATGGCTTAGGGTGCATTTCAAGG - Intergenic
976349386 4:84043568-84043590 ATGACTGAGGGCCCATTGCAAGG + Intergenic
978927752 4:114269720-114269742 ATGATTTAACACCCATTTGAGGG + Intergenic
979026258 4:115581175-115581197 ATGACTTAGGCACCCTTTAAAGG - Intergenic
987733314 5:21805886-21805908 ATGGCTTGGAGCCCATTTAATGG + Intronic
990480033 5:56201336-56201358 TTGACTCAGGGCCCAGGTGAAGG - Intronic
994231859 5:97316503-97316525 ATGACTTAGGATGCATTTCAAGG + Intergenic
994681837 5:102897593-102897615 ATGACTTATGGCCTATTTACAGG + Intronic
996680255 5:126223062-126223084 ATGGCTTAGGACGCATTTCAAGG - Intergenic
1003953300 6:11139609-11139631 ATGACTTGGGGGCCATGTCAGGG + Intergenic
1003974410 6:11329125-11329147 TTGTCTTAGGGCCCTCTTGAGGG - Intronic
1004546543 6:16603594-16603616 TTGACTTAGGCCTCATTTGGAGG + Intronic
1005229496 6:23684121-23684143 AAGACTTTGGGGCCATTTGAAGG - Intergenic
1010540912 6:77091096-77091118 ACTACTTAGGACCCATTTTATGG - Intergenic
1011396404 6:86913838-86913860 AAGACTTAGGTCACATATGATGG + Intergenic
1011418593 6:87149178-87149200 AGGTCTTAGGGCCCATATTAGGG + Intergenic
1017202630 6:151772571-151772593 ATGATTGAGGCCCCTTTTGAGGG + Intronic
1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG + Intronic
1027604742 7:80287140-80287162 ATGACTTTTGGTCCTTTTGAGGG - Intergenic
1028938772 7:96495640-96495662 ATGATTTAGGGCTAATTTCATGG + Intronic
1036136741 8:6168807-6168829 ATGACTTACTGCCCTTTTCATGG - Intergenic
1037604614 8:20426809-20426831 AGGACTTAGGGGCAGTTTGATGG + Intergenic
1037717615 8:21413061-21413083 AGGATGTAGGGCACATTTGAGGG + Intergenic
1037792691 8:21960271-21960293 ATGACTGTGGGCCCGTTTCAGGG + Intronic
1049008128 8:139870184-139870206 ATGACTTGGGGCCAATTAGGTGG + Intronic
1049652979 8:143783855-143783877 TTGACTTAGGGCACAGTTGATGG - Intergenic
1052102954 9:24473092-24473114 ATTTCTTAGAGCCCATTTGATGG + Intergenic
1053548704 9:39052031-39052053 AAGACATAGGACCTATTTGAGGG + Intergenic
1058013752 9:100006864-100006886 TTGACTTAGTGCAAATTTGAAGG + Intronic
1186894892 X:13995768-13995790 ATGACATTGGGCCCACTTGGAGG + Intergenic
1192661153 X:73044337-73044359 ATGACCTTGGGCCCTTTGGAGGG - Intergenic
1192682046 X:73262572-73262594 ATCCTTTAGGGCCCACTTGAAGG + Intergenic
1201645767 Y:16230011-16230033 ATGACTTGGTGCCCTTTGGAAGG - Intergenic
1201657046 Y:16355305-16355327 ATGACTTGGTGCCCTTTGGAAGG + Intergenic
1201782891 Y:17742994-17743016 ATTACTTGGGTCTCATTTGAGGG - Intergenic
1201818662 Y:18162993-18163015 ATTACTTGGGTCTCATTTGAGGG + Intergenic