ID: 1133482360

View in Genome Browser
Species Human (GRCh38)
Location 16:6183563-6183585
Sequence ATGCTGTTATATATGAGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 212}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133482360 Original CRISPR ATGCTGTTATATATGAGAGA GGG Intronic
901618360 1:10560359-10560381 AAGCTGTTAAATATAAAAGATGG - Intronic
901835996 1:11924634-11924656 ATCCTGTTCTGGATGAGAGAGGG - Intronic
902737823 1:18412904-18412926 ATGGTGTTAAAGAGGAGAGAGGG + Intergenic
905527559 1:38650554-38650576 AGGCTGTGTTATCTGAGAGATGG - Intergenic
906468056 1:46102418-46102440 TTGCTGATATATATGAAATAAGG - Intronic
907839882 1:58146707-58146729 ATTCTGTTATATATTATAAATGG - Intronic
908224794 1:62045297-62045319 ATGCTATTTTATTTGAGAGTAGG - Intronic
909666607 1:78141534-78141556 ATGCTGTGATATTTGAGAGAAGG + Intergenic
911089256 1:94005214-94005236 ATTTTGTTAGATATGAGAGTGGG + Intronic
912902329 1:113665271-113665293 AAGTTGATATATAGGAGAGATGG - Intronic
919528705 1:198687522-198687544 ATGCCTTTATATATGAAACAAGG - Intronic
921392012 1:214625862-214625884 ATTCTATTATAAATGAGGGAGGG - Intronic
921588052 1:216971480-216971502 TTTCTGTTTTATATCAGAGAGGG - Intronic
923173472 1:231439620-231439642 ATGCTTGTATATATTATAGAGGG + Intergenic
1064222356 10:13452256-13452278 ATGCTGTCATATATGAAAACCGG - Intronic
1065202394 10:23325821-23325843 ATGCTGTAATAAATGAAAAAAGG + Intronic
1065672358 10:28133867-28133889 ATGCTGTTACTTATGGTAGAAGG + Intronic
1066105385 10:32151914-32151936 ATGCTGTAATAGAAGAGGGAAGG - Intergenic
1068738310 10:60439771-60439793 ATGCTTTTATTTCTCAGAGAAGG - Intronic
1069968541 10:72143941-72143963 AGGCTATTATATATGATAAAGGG - Intronic
1072594648 10:96860076-96860098 ATGCTGTTATCTAACAGAAATGG + Intronic
1072676186 10:97468077-97468099 ATCCTTTTATGTATGAGACAGGG + Intronic
1074625620 10:115181239-115181261 ATGCAGTTAAAAATGGGAGAAGG + Intronic
1076366414 10:129923607-129923629 ATGTTGTTATATATGTGTAAGGG - Intronic
1077964943 11:7119728-7119750 CTGCTGTGATATATCAGGGAAGG - Intergenic
1080388163 11:31822528-31822550 TTGCTGTTACATATAAGATAAGG + Intronic
1080701509 11:34648379-34648401 ATGCTTTTATATATGATAATGGG + Intronic
1080840036 11:35975740-35975762 ATGCCGTGATTCATGAGAGAAGG + Intronic
1082996037 11:59256305-59256327 ATCCTTTTAAAGATGAGAGAAGG + Intergenic
1086024230 11:82270624-82270646 ATGCTGTTACTTATGGCAGAAGG - Intergenic
1086420574 11:86633676-86633698 ATGCTGTTCTATAGGCCAGAGGG + Intronic
1086788418 11:91002543-91002565 ATGCATTTATTTATTAGAGATGG - Intergenic
1087055830 11:93935185-93935207 ATAATTTTATATATCAGAGAAGG - Intergenic
1088075239 11:105840429-105840451 ATGCTGTCAAATTTGAGGGACGG - Intronic
1090870416 11:130740391-130740413 ATGCTTGTATATCTGAGAAAAGG + Intergenic
1093301483 12:17463890-17463912 ATGCTGATATTTATGGGAGTGGG + Intergenic
1096586402 12:52623686-52623708 ATTATATTATAAATGAGAGACGG + Intergenic
1096688264 12:53303404-53303426 ATGCTGTAATATATGGGGAAGGG + Intronic
1097862562 12:64532825-64532847 ATGCTGTTGTTTTTGAGATAGGG - Intergenic
1098672008 12:73242607-73242629 TTTCTGTTATACATGAGTGAGGG - Intergenic
1100061710 12:90586625-90586647 ATGATGAGATATCTGAGAGAAGG + Intergenic
1101431783 12:104633011-104633033 ATGCTCTGAAAAATGAGAGATGG - Intronic
1101690098 12:107070498-107070520 ATGCATTTATGTATGGGAGAAGG + Intronic
1105643665 13:22292922-22292944 ATGCTGTTATCTCTGAGTAATGG - Intergenic
1105726269 13:23165342-23165364 ATTATGTTATATATGAGATAAGG + Intergenic
1106745490 13:32701031-32701053 TTGATGTAATATATGAGACAGGG + Intronic
1107606641 13:42064043-42064065 ATGTCCTTATATATGCGAGATGG + Intronic
1109374204 13:61468638-61468660 ATGCTGTTAGGTAAGAGAGGGGG + Intergenic
1109414286 13:62015823-62015845 ATTATGTTTTATATTAGAGAAGG - Intergenic
1111684250 13:91482418-91482440 ATGCTGCTATATCTAAGACAGGG - Intronic
1111711048 13:91814862-91814884 ATGCTGTTATACATGAGAGTAGG + Intronic
1112114875 13:96340758-96340780 ATACTATTCTATATAAGAGATGG + Intronic
1112853660 13:103736908-103736930 ATGCTGTAATAAATGAGTGGGGG - Intergenic
1113157930 13:107346537-107346559 ATCCTCTTATATATGACAGATGG + Intronic
1114166822 14:20227053-20227075 CTGCTGTTATACACGACAGATGG + Intergenic
1116757162 14:48962357-48962379 ATGCTGTTATATATCATACACGG + Intergenic
1117047264 14:51826122-51826144 ATGCTGTCATGTATATGAGAGGG + Intergenic
1117711606 14:58535568-58535590 ATGCTATTATTTAAGAGAGTTGG + Intronic
1117741145 14:58820410-58820432 TTGCTGCTATAAATGAGATACGG + Intergenic
1118540327 14:66815911-66815933 ATGCCATTGTATATGTGAGATGG - Intronic
1118612800 14:67554555-67554577 ATGGTGTTAGACATGAGAGCGGG + Intronic
1118913559 14:70081947-70081969 AAGCTGTTATTTATAAGGGAGGG - Intronic
1120015309 14:79466808-79466830 ATGCTGATAGATAAGAGATAGGG + Intronic
1120227088 14:81802897-81802919 ATGCTATTTGATATGAGACAAGG - Intergenic
1120289427 14:82547991-82548013 ATGATGCTTTATATGAGGGATGG + Intergenic
1120682469 14:87497017-87497039 TTGATGTTATTTAAGAGAGAAGG + Intergenic
1120926548 14:89802970-89802992 ATGCTCTGATATAGCAGAGAGGG + Intronic
1128669026 15:69560484-69560506 TTGCTGTTATTTTTGAGACAGGG - Intergenic
1130088741 15:80801451-80801473 ATGCTGTTCTGTGAGAGAGAAGG + Intronic
1130604512 15:85303425-85303447 AAGTTGTTATATGTGAGATAGGG - Intergenic
1131330226 15:91491150-91491172 TTTTTGTTATATAGGAGAGATGG - Intergenic
1132178017 15:99731256-99731278 ATGCAGTTCTAAACGAGAGAAGG + Intronic
1133482360 16:6183563-6183585 ATGCTGTTATATATGAGAGAGGG + Intronic
1133844553 16:9441838-9441860 ATGCAGTTAAATAAAAGAGAAGG - Intergenic
1134140792 16:11716968-11716990 ATCATTTTATAAATGAGAGAGGG + Intronic
1135048388 16:19172461-19172483 ATGCTGTTATGAATCAGAGCGGG - Intronic
1137843695 16:51665832-51665854 ATGCTATTAAATATGATTGATGG - Intergenic
1138238027 16:55402048-55402070 ATGCTGTTATAGGTGGGACATGG + Intronic
1139309305 16:66014817-66014839 CTGCTGCTAGATATCAGAGAGGG - Intergenic
1139499401 16:67349691-67349713 ATACTGGGAAATATGAGAGAAGG - Intronic
1140423196 16:74837703-74837725 ATGTTGTTATTTTTGAGACAGGG - Intergenic
1140702051 16:77589823-77589845 ATGCTTTTCTAGATGAGAGGAGG - Intergenic
1140708400 16:77653088-77653110 ATGCTGGTCTACAGGAGAGAAGG - Intergenic
1141888075 16:86906819-86906841 ATCCTGTTATTAATGAGAGTTGG + Intergenic
1142484665 17:238925-238947 CTGCTGTCATATATGAGCAATGG + Intronic
1146981938 17:37171363-37171385 ATTTTGTTATATATCTGAGAAGG - Intronic
1150472501 17:65449042-65449064 GTGCTGTAAGATGTGAGAGAGGG + Intergenic
1156602587 18:38626990-38627012 ATTCTGTTATATAGAAGATATGG - Intergenic
1158360595 18:56668080-56668102 AAGCTGTGATATAACAGAGAGGG - Intronic
1158419094 18:57276978-57277000 ATGCTGGTATATATTATATATGG - Intergenic
1158440981 18:57474104-57474126 ATACTTTTAGAAATGAGAGAAGG + Intronic
1159996879 18:74973254-74973276 ATAATTTTATAAATGAGAGATGG - Intronic
1160217336 18:76944042-76944064 ATGCTGTAAAATATGAGCAAGGG - Intronic
1160669507 19:353112-353134 ATTCTGTTATGTAGGAGAGGGGG - Intergenic
1161730284 19:5956100-5956122 ATGTTTTTATCTTTGAGAGACGG - Intronic
1162803692 19:13125275-13125297 AAGGTGCTATCTATGAGAGATGG - Intronic
1162826925 19:13258335-13258357 ATGGGGATATATATGAGAGTGGG + Intronic
926553938 2:14334589-14334611 ATGTTCTTATATATCAGAGGGGG + Intergenic
926789493 2:16556086-16556108 ATGCTGTTATATATTGGATTTGG + Intronic
933056980 2:77682980-77683002 ATGCAGTTATATATTAGAACAGG + Intergenic
933199216 2:79429741-79429763 ATGTGGTTTTATTTGAGAGAAGG + Intronic
933512852 2:83263087-83263109 ATGCTATTATATAGTAAAGAAGG + Intergenic
933927112 2:87104123-87104145 ATGCAGTTATATATTAGAACAGG + Intergenic
937334499 2:121053673-121053695 ATGCTGTATTATATGTGATATGG - Intergenic
937979020 2:127602297-127602319 ATTGTATTACATATGAGAGAAGG - Intronic
939018931 2:136936033-136936055 AAGCTGTTAAACAGGAGAGAGGG - Intronic
939382250 2:141450491-141450513 ATGATGTTATGTATAAGAAATGG - Intronic
942419483 2:175793551-175793573 ATGCTGTTAAACACTAGAGAAGG + Intergenic
947284594 2:228498615-228498637 ATTCTGTTATCTTTGAGAGTAGG - Intergenic
948769143 2:240239205-240239227 TTGATGTTATATATGCCAGAAGG + Intergenic
1169494948 20:6106403-6106425 ATGCTGGTGTAGATGAGAAAGGG + Intronic
1170132387 20:13034800-13034822 ATGCTGTTATAGATGATGGTTGG + Intronic
1171726067 20:28621902-28621924 ATGCTGTAATTTAAAAGAGAGGG + Intergenic
1174925381 20:54753482-54753504 AGGCTGTTTTATCAGAGAGATGG - Intergenic
1185142557 22:49111174-49111196 ATCCTGTTATGTCTCAGAGAGGG + Intergenic
951619514 3:24585820-24585842 ATGCTGCGATATTTGAAAGAAGG + Intergenic
951782169 3:26376152-26376174 ATTCTGTTAAAATTGAGAGAAGG + Intergenic
952212826 3:31246774-31246796 AGTCTGTAATATATGAGAAAAGG + Intergenic
952691861 3:36217634-36217656 ATGCTTTTATGTCTGAGTGATGG + Intergenic
952803752 3:37324620-37324642 ATGATTTTACAAATGAGAGAAGG + Exonic
954284657 3:49610212-49610234 ATGCTTTTGTATGTGATAGATGG + Intronic
956411468 3:68984325-68984347 ATTCTGTTTTACAGGAGAGATGG + Intronic
959331616 3:105013050-105013072 ATGCTGCCTTATTTGAGAGATGG - Intergenic
961508063 3:127384681-127384703 ATGATGTTATATATAATAAATGG - Intergenic
961626319 3:128266371-128266393 ATGCTGCTCTAGATGAGGGATGG - Intronic
962728920 3:138261568-138261590 GTATTGTTATATATAAGAGATGG + Exonic
964507450 3:157415063-157415085 ATGGTGTCATTTATGAGAAAAGG - Intronic
964529027 3:157647044-157647066 ATGCTGCTATATATAAAAGCTGG + Intronic
964747310 3:160024468-160024490 ATGCTGTTTAAAATGAAAGAAGG - Intronic
965277432 3:166703818-166703840 ATACTGTTATATATGCAAGTAGG + Intergenic
967858651 3:194135781-194135803 GCTCTGTTACATATGAGAGAGGG + Intergenic
970774568 4:19657456-19657478 ATGCTGTTATATTTGATATATGG + Intergenic
973912436 4:55594691-55594713 ATTCTGGTATTTATGAGAGCTGG + Intergenic
974232016 4:59128713-59128735 TTGCTGTTATATACTACAGATGG + Intergenic
974409776 4:61525132-61525154 ATGCTGTCATATTTTAAAGAAGG + Intronic
974606083 4:64152606-64152628 ATGCTGATTTGTATGGGAGACGG - Intergenic
975856881 4:78633932-78633954 ATGCTGTTATATTTGAGGGAGGG - Intergenic
976478580 4:85512792-85512814 ATTCTTTGATATATGAGAAATGG + Intronic
976697987 4:87938369-87938391 AAAATGTTATATATGAGACAGGG - Intergenic
976828175 4:89283641-89283663 ATGCTGGCATATCTAAGAGAAGG + Intronic
979377515 4:119964414-119964436 AAGCTCTTAGATATGGGAGAAGG + Intergenic
979568128 4:122180001-122180023 ATGCACGTGTATATGAGAGATGG - Intronic
981608196 4:146563003-146563025 ATGCTTTTAAATATCAGAGCAGG + Intergenic
982491524 4:156036515-156036537 ATGCTGTATTATATATGAGATGG - Intergenic
983195622 4:164803223-164803245 ATGCAGTAATATATGTAAGATGG - Intergenic
986868190 5:12014965-12014987 ATGCTGTTAAAAATGACAGTGGG + Intergenic
987483738 5:18495301-18495323 ATTGTATTATATATAAGAGATGG + Intergenic
987646418 5:20678170-20678192 TTCCTGTTATAAATGATAGATGG - Intergenic
988021739 5:25629581-25629603 ATTCTGTTATATAAGAGACTAGG - Intergenic
988462570 5:31453656-31453678 AAGCTGTTTTACATGAGAAAAGG - Intronic
989303548 5:39924340-39924362 ATGTTGATATATATGAGTGGTGG + Intergenic
989837126 5:46007133-46007155 ATGCTGAAAGATATGAAAGAGGG - Intergenic
990088657 5:52012349-52012371 TTGCTTTTATATTGGAGAGAAGG + Intronic
990183901 5:53192144-53192166 ATGGTGGTATATTTCAGAGAGGG - Intergenic
990424631 5:55674086-55674108 ATTCTGTGATATTTGAGAAATGG + Intronic
990566862 5:57038572-57038594 ATTATTTTATATATGTGAGATGG - Intergenic
990964275 5:61428365-61428387 AGGCTGTTTTATTTTAGAGATGG + Intronic
991711215 5:69410698-69410720 ATGCTGTTATATTTAAGAAAAGG - Intronic
992147493 5:73866225-73866247 ATGATCTTTTATATTAGAGAGGG + Intronic
992467983 5:77026004-77026026 ATACTGTAGTATATTAGAGAGGG - Intergenic
992581286 5:78179819-78179841 ATGCTGCTAAATATGAGTAAAGG - Intronic
992648178 5:78831654-78831676 ATGCTGTTAAATATCAGAGCTGG - Intronic
994524831 5:100892452-100892474 ATGCAATTGTCTATGAGAGATGG - Intronic
994548032 5:101193563-101193585 ATTCTGTGATGTATGAGAAAAGG - Intergenic
994560947 5:101371611-101371633 AGTCTGCTATAAATGAGAGAAGG + Intergenic
994971013 5:106737194-106737216 AGGCTATTATCTATCAGAGAAGG + Intergenic
996439170 5:123470253-123470275 ATGCTGTTATCCATGTGATATGG - Intergenic
997078757 5:130713539-130713561 TAGCTGTTACATATGAGAAAAGG - Intergenic
997986062 5:138502412-138502434 CTAATGTTATAAATGAGAGAAGG - Intergenic
999665309 5:153906579-153906601 ATGAGGTAATATATGTGAGATGG - Intergenic
999971825 5:156871530-156871552 ATGATTTTATAAATAAGAGATGG + Intergenic
1001640584 5:173241130-173241152 GTGCTTTTATATTTGAGAGGGGG + Intergenic
1002513480 5:179739345-179739367 ATTCTATTCTATTTGAGAGATGG - Intronic
1005403218 6:25457003-25457025 ATGCTTTTATAAATGAGACCAGG - Intronic
1006618837 6:35348304-35348326 TTGCTGGTATATATGAGAGCTGG + Intronic
1009697540 6:67127409-67127431 TTGTTGTTATTTATGAGAGAAGG - Intergenic
1010363439 6:75021966-75021988 ATGCTGTTATATGTAATACAAGG + Intergenic
1010567160 6:77430368-77430390 ATGATGCTATAAATGAGAGAAGG - Intergenic
1011124679 6:83994497-83994519 ATGCTGTTAGAAATCAGAGAAGG - Intergenic
1011884030 6:92070437-92070459 ATTCTGTTAGGAATGAGAGAAGG - Intergenic
1012858184 6:104527868-104527890 AGGCTGTGTTATAGGAGAGATGG + Intergenic
1017371231 6:153711430-153711452 AAGCTATCAGATATGAGAGATGG - Intergenic
1017961319 6:159223664-159223686 TTGTCTTTATATATGAGAGATGG + Intronic
1018478324 6:164165660-164165682 ATGCTTTTTTTTTTGAGAGAAGG + Intergenic
1020743001 7:12045812-12045834 ATGCTATTATTTATGAAGGAAGG - Intergenic
1020903991 7:14042009-14042031 ATTCTGTTAGATATCAGAAAAGG + Intergenic
1021536858 7:21715197-21715219 ATCCTGTTGTATAGGATAGAAGG - Intronic
1022885992 7:34644380-34644402 ATTTTGTCACATATGAGAGAAGG + Intergenic
1023493520 7:40769379-40769401 ATGCTATCATATATGACAAAAGG + Intronic
1024868375 7:53931472-53931494 ATGGAGTTAGATCTGAGAGATGG + Intergenic
1026650484 7:72212049-72212071 TTGCTGTTAAATACCAGAGAGGG + Intronic
1027000834 7:74653010-74653032 ATAATATAATATATGAGAGACGG + Intergenic
1027498290 7:78916003-78916025 ACGTTTTTATATAAGAGAGATGG + Intronic
1028379147 7:90178495-90178517 ATGCTGCTTCTTATGAGAGACGG - Intronic
1028726661 7:94095811-94095833 ATGCTATTATATCTGACAGCAGG - Intergenic
1028936215 7:96466620-96466642 ATGATGATATACAAGAGAGAAGG - Intergenic
1030847141 7:114433501-114433523 ATGATGGTATATTTGAGAAATGG - Intronic
1031552178 7:123128538-123128560 GTGCTGTTATATTTCAGGGATGG + Intronic
1033056298 7:138058079-138058101 ATGTCTTTATATAAGAGAGAGGG - Intronic
1039462912 8:37761217-37761239 ATGCTATTATATTAGAGAAATGG - Intergenic
1039877980 8:41603679-41603701 ATGCTGTGATATGTGAGATTAGG + Intronic
1040810202 8:51444107-51444129 ATGCTGTTATTGATGAAACAGGG - Intronic
1040882982 8:52228687-52228709 TTGATGTTACATATGAGAAAAGG + Intronic
1042774978 8:72420123-72420145 ATGCTCTGAAATATGAGAGGAGG - Intergenic
1042809868 8:72812429-72812451 CTGCTGTTACAAATGAGACAAGG - Intronic
1046192165 8:110810381-110810403 ATGCTTGTATATATAAGATATGG + Intergenic
1046599468 8:116299385-116299407 TTGATGTTATACATGACAGAGGG + Intergenic
1047029702 8:120862931-120862953 GGGCTGTAATTTATGAGAGAAGG + Intergenic
1047213775 8:122860733-122860755 TTGCTGAAATATATCAGAGAGGG + Intronic
1052456987 9:28712357-28712379 AAGTTTTTATATATAAGAGATGG - Intergenic
1052597796 9:30582827-30582849 GTGCTGTTATATATGAAGTAAGG + Intergenic
1055826873 9:80338195-80338217 ATGTTGTAAGAAATGAGAGAAGG + Intergenic
1055929816 9:81548512-81548534 ATGCCATCCTATATGAGAGAAGG + Intergenic
1056399939 9:86216784-86216806 ATGCTATTTTAAAAGAGAGAAGG + Intergenic
1057977575 9:99622613-99622635 CTGCTGCTATATATAACAGACGG - Intergenic
1186211892 X:7258242-7258264 ATGATGATAGATATGATAGATGG + Intronic
1186751900 X:12630110-12630132 GTTCTGTCATATATGAGTGAAGG + Intronic
1187308900 X:18122070-18122092 ATGCTGCTAGAAAGGAGAGATGG - Intergenic
1188879216 X:35471387-35471409 ATGCTGGTATTTAGGGGAGATGG + Intergenic
1189268502 X:39734269-39734291 ATGATGTCATATATGTGAAACGG - Intergenic
1195005091 X:100678067-100678089 ATGCTGTTAATAATGAAAGAAGG - Intronic
1195121412 X:101757089-101757111 ATTCTGTTATATAGAATAGATGG - Intergenic
1195578934 X:106480019-106480041 ATGCTTGTATGTATTAGAGAGGG - Intergenic
1196120992 X:112050395-112050417 ATACTGCTATAAATGAGAGCAGG - Intronic
1198179289 X:134189584-134189606 ATGCAGTTATAGTTTAGAGAGGG - Intergenic
1200877081 Y:8168389-8168411 TTGCTGTAATTTATGAGTGAGGG + Intergenic