ID: 1133484192

View in Genome Browser
Species Human (GRCh38)
Location 16:6202745-6202767
Sequence AATTACATAAAGAACGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 168}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133484192_1133484195 23 Left 1133484192 16:6202745-6202767 CCTCCCACGTTCTTTATGTAATT 0: 1
1: 0
2: 1
3: 12
4: 168
Right 1133484195 16:6202791-6202813 TTTCATTTTGTTTCTGAGACAGG 0: 1
1: 4
2: 157
3: 2742
4: 21870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133484192 Original CRISPR AATTACATAAAGAACGTGGG AGG (reversed) Intronic
900433885 1:2617511-2617533 AATTACTTGAACACCGTGGGTGG + Intronic
900840134 1:5042115-5042137 AATTACATAAAGAATGGGGTTGG - Intergenic
905591358 1:39166776-39166798 AATGACATAAACAACTAGGGTGG + Intronic
906522855 1:46477535-46477557 GAGTACATAAAGAGCCTGGGAGG + Intergenic
907339322 1:53723323-53723345 AATTGCTTGAAGAACATGGGAGG - Intronic
908178446 1:61579512-61579534 AAATACACAAAGAACTTGGGAGG + Intergenic
908402082 1:63780811-63780833 AATTACACTAAGCACCTGGGAGG - Intronic
912621921 1:111169365-111169387 AATTTCATTAAGAACATTGGTGG - Intronic
916401649 1:164455238-164455260 AACAATACAAAGAACGTGGGTGG + Intergenic
916974949 1:170066179-170066201 TATAACATAAAGAATGGGGGGGG - Intronic
917223623 1:172758504-172758526 AATTACAGAAAGAAAGTGGGAGG - Intergenic
918773941 1:188604217-188604239 AAACACTTAAAGAACTTGGGAGG - Intergenic
921261460 1:213388469-213388491 AATTGCATGAAGAATGTGGGAGG - Intergenic
922372452 1:224925040-224925062 AAATAAATAAATAAGGTGGGGGG + Intronic
923915947 1:238505129-238505151 AATTTCAAAAAGAATGGGGGAGG + Intergenic
924108185 1:240670585-240670607 AATCACATAATGAACTTTGGGGG - Intergenic
1062851022 10:743477-743499 GATACCATAAAGAATGTGGGCGG + Intergenic
1063924798 10:10967149-10967171 AATGACCTACAGAACGTGGGAGG + Intergenic
1068289298 10:54981765-54981787 AATTAATTAAAGGAGGTGGGGGG - Intronic
1068586622 10:58807226-58807248 AGGTACATAAAGAATGAGGGTGG - Intronic
1070843406 10:79503567-79503589 AATTACAGGAAGATGGTGGGGGG + Intergenic
1070930259 10:80256034-80256056 AATTACAGGAAGATGGTGGGGGG - Intergenic
1071699740 10:87917728-87917750 AATAGCATAAAGAACTTGGTGGG + Intronic
1073499684 10:103925146-103925168 AATAGCACAAAGAAGGTGGGAGG - Intergenic
1077564731 11:3290350-3290372 CATTACAGAAAGATGGTGGGGGG + Intergenic
1077570620 11:3336167-3336189 CATTACAGAAAGATGGTGGGGGG + Intergenic
1079596547 11:22256465-22256487 AAATACATTAACAATGTGGGTGG + Intronic
1082127009 11:48445237-48445259 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1082560590 11:54616218-54616240 AGTTTTATAAAGAAAGTGGGAGG + Intergenic
1084407219 11:68981083-68981105 TGTTACATAAAGAACCTGGAGGG - Intergenic
1086187686 11:84039077-84039099 AATTACCTAAACATTGTGGGCGG - Intronic
1086762917 11:90656097-90656119 AATTACAAAAAGATCCTGGTAGG - Intergenic
1089974576 11:122721313-122721335 AATTCCATAAAGAGCTTGGCTGG - Intronic
1095720970 12:45400015-45400037 CATTTCATAAACCACGTGGGAGG + Intronic
1099224578 12:79954402-79954424 AATTACATAAAGTGTGTGGAGGG - Intergenic
1099533837 12:83821561-83821583 AATTAGATAAAGTTGGTGGGAGG + Intergenic
1102635877 12:114323420-114323442 AGTTAGATAAAGAACATGAGAGG - Intergenic
1106663522 13:31827151-31827173 TATTACAGAAAGAAGCTGGGTGG + Intergenic
1108251390 13:48571402-48571424 AATTACATAAAACACATGGCAGG - Intergenic
1108887737 13:55209079-55209101 AAAAACATAAACAAAGTGGGTGG + Intergenic
1109150506 13:58842090-58842112 AATTACAGCAAGAAGGTGGAGGG - Intergenic
1109523464 13:63544104-63544126 AATTACAAATAGAAGGTGAGAGG - Intergenic
1110938028 13:81317482-81317504 AATTACATAAAGGGCTTGAGAGG - Intergenic
1114372065 14:22100645-22100667 AAATACATAAATAACTTGTGAGG - Intergenic
1114825428 14:26072047-26072069 AATAACAGAAAGATCCTGGGGGG - Intergenic
1115101535 14:29707140-29707162 AATTTCATAAATAATGTAGGAGG + Intronic
1119623047 14:76147386-76147408 AATCACATAATGAAAGAGGGTGG - Intergenic
1122718834 14:103710996-103711018 ATTTACATAAAGGGTGTGGGTGG - Intronic
1123895033 15:24820154-24820176 AACTGCATAAAGAAAGTGGGAGG + Intergenic
1124088371 15:26573752-26573774 AAATACATAAAGAATGCGGCTGG + Intronic
1125435639 15:39642296-39642318 AATTAAATAAAAAACAGGGGTGG - Intronic
1127183370 15:56450072-56450094 GATTACAAAAAGAAGGTAGGAGG - Intronic
1128432963 15:67617239-67617261 AATTAAAGAAAGAATGGGGGAGG - Intronic
1128474248 15:67983617-67983639 AATAAAATAAAGAATGTGGCTGG + Intergenic
1129540560 15:76343924-76343946 AATTACTGAAAGAAAATGGGAGG + Intergenic
1133484192 16:6202745-6202767 AATTACATAAAGAACGTGGGAGG - Intronic
1138532003 16:57639617-57639639 AGATACATTAAGAACGTGCGTGG - Intronic
1139080804 16:63518065-63518087 AATAGCATAAAGAAGATGGGTGG - Intergenic
1140833095 16:78769522-78769544 AAATAAATAAATAATGTGGGGGG - Intronic
1141535584 16:84677592-84677614 TATTACACACAGAACGGGGGGGG + Intergenic
1145221175 17:21090271-21090293 TTTTACATAAGGAAAGTGGGTGG + Intergenic
1146643904 17:34563653-34563675 AATTACATGGGGAATGTGGGAGG - Intergenic
1146775457 17:35610458-35610480 AATTACATAAAGAAATTAGTTGG + Intronic
1146805469 17:35861678-35861700 AAAGACATAAAGAAAGTGAGTGG - Intronic
1147731693 17:42607839-42607861 AAATAAATGAAGAACGTGGTAGG + Intronic
1149644989 17:58234102-58234124 AAATAAATAAATAAAGTGGGGGG + Intronic
1150688366 17:67339688-67339710 ACTTAAATAAAGAAAGTGTGAGG - Exonic
1150996549 17:70324463-70324485 AAGTACATAAAGAATGTACGTGG - Intergenic
1153093513 18:1374678-1374700 AATTAGATAAAGGAGGTGGTTGG + Intergenic
1155306580 18:24484496-24484518 AAGTACATAAAGACAGTGGTGGG + Intergenic
1156553779 18:38044933-38044955 GATTACAGAAAGAAAGAGGGAGG + Intergenic
1158051973 18:53233275-53233297 AATTACATGAAGAAATAGGGAGG - Intronic
1159372612 18:67547739-67547761 AATGCCACAAAGAACATGGGAGG - Intergenic
1163436535 19:17299237-17299259 AATTATATAGAGAATGGGGGGGG - Intronic
1164322799 19:24165706-24165728 AACCACATAAAGAACATGAGTGG - Intergenic
1165501109 19:36190175-36190197 AAATACATACAGAATGTGGTAGG + Intronic
1167359463 19:49022537-49022559 AATTACATAAAGAAATTAGCTGG - Intergenic
925390830 2:3492772-3492794 AATTACAAAAAGGACGGGCGCGG - Intergenic
925957728 2:8984647-8984669 AAATAAATAAAGAACTAGGGGGG + Intronic
926149833 2:10419229-10419251 AAACAAATAAAGAAGGTGGGTGG + Intronic
929480460 2:42302488-42302510 AATCACATGAAGAATGTGGTCGG - Intronic
933012244 2:77081045-77081067 AATTACATAAGCAGCATGGGAGG - Intronic
933294272 2:80471828-80471850 AAATGCATAAAGAAGGTGGCCGG + Intronic
933378144 2:81507499-81507521 AATTAAATAAAGATAGTGGTAGG + Intergenic
935003862 2:99050056-99050078 AAATGCACAAAGAACGTGGGTGG + Intronic
935436621 2:103042461-103042483 AATTCCATGAAGAATGTTGGCGG - Intergenic
935509455 2:103953048-103953070 TATTTCATAAAGAAAGTGGTAGG - Intergenic
936923640 2:117714580-117714602 ATTTACTTAAAGAAGGTGGAGGG - Intergenic
942885226 2:180915480-180915502 AACTTGATAATGAACGTGGGTGG + Intergenic
943512682 2:188845486-188845508 AATTCTATAAAAAACATGGGGGG - Intergenic
943754676 2:191545647-191545669 AGTGACCCAAAGAACGTGGGTGG - Intergenic
945378095 2:209103527-209103549 AAATACATAAAGAAATGGGGAGG + Intergenic
946972086 2:225105100-225105122 AAATACAAAAAGTACCTGGGTGG + Intergenic
1169356308 20:4909396-4909418 GAATATATAAAGAACGTAGGGGG + Intronic
1170324950 20:15147448-15147470 AATTACACAAAGACCCTGGCTGG - Intronic
1172716426 20:36967677-36967699 ATCTATATAAAGAACATGGGAGG - Intergenic
1172718588 20:36982442-36982464 GTCTACATAAAGAACATGGGAGG + Intergenic
1174272460 20:49379719-49379741 AATAAAATAAAGAAGGTGAGTGG - Intronic
1174969718 20:55261061-55261083 CATTACACAAAGCACTTGGGGGG - Intergenic
1179536217 21:42054511-42054533 AAATCCATAAAGAACGTGAGAGG - Intergenic
1180597140 22:16985039-16985061 AATTACCCAAAGACCCTGGGAGG - Intronic
1181385015 22:22538354-22538376 AAATACATAAAAAATGAGGGGGG + Intergenic
1183300567 22:37057061-37057083 AATTCAAGAAAGAACATGGGTGG - Intronic
949335008 3:2965187-2965209 AATGAGACAAAGAATGTGGGAGG - Intronic
952361612 3:32635874-32635896 AATTAAATAATTCACGTGGGAGG - Intergenic
952644937 3:35644649-35644671 AATTACATCAAGACAGTGGAGGG + Intronic
953520937 3:43642675-43642697 AATTACCTATAGGAGGTGGGGGG - Intronic
955938486 3:64126130-64126152 AATTTCATGAAAAACTTGGGGGG + Intronic
959715207 3:109425149-109425171 AATTACATAATGGACTTTGGGGG - Intergenic
960326588 3:116303914-116303936 AATCACTTAAATAACGTGGCTGG + Intronic
962872645 3:139511335-139511357 AATTACTTCAAGAAGGTGAGAGG + Intergenic
963301664 3:143604237-143604259 ACTTCCATAAAGAACTTGAGTGG - Intronic
964786716 3:160403514-160403536 AATTACATAATGAAATTGGGAGG + Intronic
965284052 3:166794158-166794180 AATTACATAATGGACTTTGGGGG - Intergenic
966826392 3:183968408-183968430 AAGTAAATAAAGAATATGGGTGG - Intronic
966936408 3:184712315-184712337 ACTTGCAGAAAGAACGTGGGGGG - Intergenic
969094428 4:4721180-4721202 AATAACAAAAAGAACCCGGGGGG + Intergenic
969880643 4:10170680-10170702 AATTACAAAAACAAAGTGTGGGG - Intergenic
974312174 4:60226898-60226920 AATTCCATAAATAACTTGGCAGG + Intergenic
975037727 4:69705041-69705063 TATTACATAAAAAACAAGGGAGG + Intergenic
977714659 4:100168313-100168335 AATTACATGAACACAGTGGGAGG + Intergenic
978349446 4:107806264-107806286 AAGTACAAATAGAACTTGGGTGG - Intergenic
983705639 4:170655219-170655241 AAATAAATAAAGAAGGTAGGAGG + Intergenic
984235232 4:177149135-177149157 AATTACATAAAGTTTGTTGGGGG + Intergenic
984953463 4:185023354-185023376 ACTTACTTAAAGAAAGTGGAGGG - Intergenic
986693762 5:10334173-10334195 AAATACATAAATAAGGTGGAAGG + Intergenic
988929651 5:36024566-36024588 AATTACAAAAAGAACTTAGAAGG + Intergenic
989606879 5:43252923-43252945 AAATAGATAAATAAAGTGGGAGG - Intronic
992462342 5:76972884-76972906 TATCACAGAAAGAATGTGGGTGG + Intronic
992877736 5:81074480-81074502 TATTACGTATAGAAAGTGGGGGG - Intronic
994144179 5:96374239-96374261 AATAAAATAAAGAAAGAGGGAGG - Intergenic
999072266 5:148757807-148757829 AATAACATAAAGTGTGTGGGAGG - Intergenic
999706286 5:154275192-154275214 AATTCTAAAAAGCACGTGGGAGG + Intronic
1000545777 5:162599870-162599892 AGTAACATAAAGGACGTGAGTGG - Intergenic
1003810897 6:9779553-9779575 AATTAAACAAAGAACTTGTGGGG + Intronic
1006248026 6:32757410-32757432 AAGGACTTAAAGAACATGGGAGG - Intronic
1008578586 6:52884649-52884671 TATTACAAGAAGAAAGTGGGTGG - Intronic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1010566773 6:77425251-77425273 AATTTCCTCAAGAAAGTGGGTGG - Intergenic
1012271471 6:97217585-97217607 AATTATATAATTAACGTGGGAGG - Intronic
1012937621 6:105384562-105384584 ACTTATATAAACAACGTGGAAGG - Intronic
1013256436 6:108390990-108391012 AAATACATAAAGAAATTGTGGGG - Intronic
1013963853 6:115932201-115932223 AATTTCATAAATAACTTGAGAGG + Exonic
1016568336 6:145484570-145484592 AATTACATACAGAATGTAGATGG - Intergenic
1023245240 7:38196145-38196167 AATTAGAAAAAGGATGTGGGAGG + Intronic
1023876247 7:44287838-44287860 ACTAACCTAAGGAACGTGGGAGG - Intronic
1030130818 7:106198095-106198117 AATTACAGAAATAAACTGGGAGG - Intergenic
1034000874 7:147411639-147411661 ATTTTCATAAAGAAAGTAGGAGG + Intronic
1035782387 8:2238777-2238799 AACTACATAAAGGGCGTGGGGGG - Intergenic
1035809732 8:2480811-2480833 AACTACATAAAGGGCGTGGGGGG + Intergenic
1036165821 8:6432266-6432288 GATTACTTAAAGTACATGGGAGG - Intronic
1038203689 8:25442516-25442538 AATTATATAAAGATGGTGGATGG + Intronic
1038613333 8:29072527-29072549 AAATAAATAAAGAACATGGCTGG + Intronic
1041061554 8:54039709-54039731 AATTAGAAAAAGAACATGGAGGG - Intergenic
1042934556 8:74045767-74045789 AGTTACATAAAGGAGGTAGGGGG - Intergenic
1043199541 8:77348867-77348889 AATTACTTTAAGAACTTGGCAGG - Intergenic
1044446317 8:92280888-92280910 AATTAGAGAAAGAAAGGGGGGGG + Intergenic
1046170853 8:110503124-110503146 AATTACATTAAGAGCTTGGAAGG - Intergenic
1046759310 8:118004759-118004781 TATTACATGGAGAATGTGGGTGG - Intronic
1047658973 8:127011718-127011740 AATCACATAGAGAAGGGGGGTGG + Intergenic
1049428128 8:142546500-142546522 AGTTACGGAAAGAACCTGGGAGG + Intergenic
1050601899 9:7261433-7261455 AATTACATAAAGAACAAGCTGGG - Intergenic
1055035551 9:71814480-71814502 AATCACATTAAGACCATGGGAGG - Intronic
1056389799 9:86130545-86130567 AACTATCTAAAGAACGCGGGTGG - Intergenic
1056442540 9:86635091-86635113 AAGGACATCAAGAACATGGGAGG + Intergenic
1057111048 9:92471584-92471606 AATTACTTAAAGGAAATGGGTGG - Intronic
1057478495 9:95425901-95425923 AATTACAGAAAGTAAGTGGTGGG + Intergenic
1058125790 9:101193267-101193289 AATTACAGAAAGACAGGGGGTGG - Intronic
1059186860 9:112282087-112282109 GATTACATGATGAAGGTGGGTGG - Intronic
1060772010 9:126338595-126338617 AATTTAATAAAGAACATGTGAGG - Intronic
1188343261 X:29031412-29031434 AATGACATAAAGAATGAGTGAGG + Intronic
1188651538 X:32636670-32636692 AATAACATAAAGAAGCTGCGTGG + Intronic
1190263185 X:48811813-48811835 AACAAAATAAAGAACGTCGGAGG - Intronic
1190737723 X:53266798-53266820 AATTCCAAGAAGAAGGTGGGGGG + Intronic
1191594512 X:62927815-62927837 AATAAAATAAGGAATGTGGGAGG - Intergenic
1192834286 X:74782654-74782676 AAGCACATAAAGAGGGTGGGAGG - Intronic
1193557224 X:82969917-82969939 AATTGAATACAGAATGTGGGAGG - Intergenic
1193599290 X:83489515-83489537 AATTAATTAAAGAACTTGGCAGG + Intergenic
1195237649 X:102917561-102917583 AATGACAGAGAGAAGGTGGGAGG + Intergenic
1196226183 X:113169778-113169800 AATTAGATAAAGCAGGTAGGTGG + Intergenic
1198392023 X:136185797-136185819 ATTTATATAACGAACGTGGATGG + Intronic
1202628449 Y:56884011-56884033 AACTACAAAAAAAAGGTGGGGGG + Intergenic