ID: 1133488006

View in Genome Browser
Species Human (GRCh38)
Location 16:6239116-6239138
Sequence CAGTGTATGCTGTGGGAATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 273
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 245}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133488006_1133488014 20 Left 1133488006 16:6239116-6239138 CCCCATTCCCACAGCATACACTG 0: 1
1: 0
2: 3
3: 24
4: 245
Right 1133488014 16:6239159-6239181 TCAATGATTGGAATAAATAACGG 0: 1
1: 0
2: 1
3: 35
4: 331
1133488006_1133488013 8 Left 1133488006 16:6239116-6239138 CCCCATTCCCACAGCATACACTG 0: 1
1: 0
2: 3
3: 24
4: 245
Right 1133488013 16:6239147-6239169 CATGTCGCTTATTCAATGATTGG 0: 1
1: 0
2: 0
3: 7
4: 60

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133488006 Original CRISPR CAGTGTATGCTGTGGGAATG GGG (reversed) Intronic
904353625 1:29924606-29924628 CAGTAAATGCTGAGGGAAGGAGG - Intergenic
904661493 1:32088820-32088842 CAGGGTATCTTGTGGTAATGAGG - Intronic
904963288 1:34351501-34351523 CTGTGTTTTCTGTTGGAATGGGG + Intergenic
905874885 1:41426375-41426397 AAGTGTCTGCTGTGGGAACCCGG + Intergenic
906320184 1:44810796-44810818 CTGTGTGTGCTGTGGGAAGAGGG + Intronic
907011520 1:50968319-50968341 CAGCGTACGCTGCGGGAAGGCGG - Exonic
908376499 1:63547461-63547483 TAGTGAGTGCTGAGGGAATGTGG + Intronic
908523877 1:64969125-64969147 AAGTATATGCTGTGTGACTGGGG + Intergenic
910296748 1:85654471-85654493 CAGTATATGTTGAGTGAATGTGG + Intronic
910661517 1:89678864-89678886 AAGGGTTTGCTGTGGGGATGGGG + Intronic
912313336 1:108645029-108645051 CAGTGTCAGCAGTGGCAATGTGG - Intergenic
913339739 1:117747023-117747045 CTGTGGCTGCTGTGGGGATGTGG + Intergenic
914924006 1:151868062-151868084 CAGTGCTTGCTAGGGGAATGAGG - Intergenic
917692758 1:177485911-177485933 CATTGTATGCTGTTGTAATCAGG - Intergenic
917742046 1:177970202-177970224 CCGTGATTGCTGTGGGAATTTGG - Intronic
918301879 1:183211971-183211993 CAGTTCATGATGTGGGAATTGGG + Intronic
920817003 1:209344061-209344083 CAGTGCATTCTGTGGCAGTGTGG - Intergenic
921155781 1:212437442-212437464 GAGTTTCTGCTGTGGGATTGTGG + Intronic
921649510 1:217659906-217659928 CATTGTATGCTATGGGAAGGAGG - Intronic
922789410 1:228302838-228302860 CAGGGTAATATGTGGGAATGTGG + Intronic
922850247 1:228727000-228727022 CAGTGTATGGTGAGGGCAAGGGG - Intergenic
923337723 1:232984860-232984882 CATTGTATTCTGGGGGCATGTGG + Intronic
923520932 1:234734529-234734551 CAGTGGATGACATGGGAATGGGG + Intergenic
923764895 1:236884175-236884197 AAATGTTTGCTGAGGGAATGAGG - Intronic
923999520 1:239535151-239535173 CAGTGTTTGCTGAAGGAAGGGGG + Intronic
924022437 1:239798483-239798505 GAGTGTCTGCTGTGTGCATGGGG - Intronic
924618859 1:245642263-245642285 CAGAATCTGCTGTGGGAAGGAGG + Intronic
1064385907 10:14891279-14891301 CAGTGTGTGTTGTGTGAATGGGG + Intronic
1065154332 10:22853954-22853976 CAGTAAAAGTTGTGGGAATGTGG + Intergenic
1066031596 10:31432239-31432261 AAATGTATGCTGTATGAATGAGG + Intronic
1067223439 10:44360381-44360403 CAGTGTGCGCTGTGGGAGTCAGG - Intergenic
1068526242 10:58133604-58133626 CAGTGTAGGCAATGGGAGTGAGG + Intergenic
1071153616 10:82664761-82664783 GAGTGCATGCTGTGGGAACACGG - Intronic
1071175724 10:82924410-82924432 CAGTTTGTGCGGTGGTAATGAGG + Intronic
1072269438 10:93761342-93761364 CAGTGTATGATGGGTGAGTGTGG - Intronic
1072906702 10:99460687-99460709 CAGTAATTGATGTGGGAATGAGG + Intergenic
1074728716 10:116344566-116344588 GAGTGAATGGTGTGTGAATGTGG + Intronic
1074899492 10:117803974-117803996 CATTGTATGTTGTGGGAGCGAGG + Intergenic
1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG + Intergenic
1076493833 10:130883765-130883787 CAGTGCATGCTGTGGGATTCTGG + Intergenic
1077053683 11:579518-579540 CAGTGCATGCTGTGGGAGAGGGG + Intronic
1077451094 11:2645981-2646003 AGGAGTCTGCTGTGGGAATGTGG + Intronic
1077798412 11:5515038-5515060 CTGTGTCTGCTGCAGGAATGTGG + Exonic
1079222183 11:18572840-18572862 CAGTGTATGCTCAGTAAATGTGG - Intronic
1080821357 11:35809728-35809750 CAGTGTACTCTGTGAGGATGTGG + Exonic
1082965968 11:58966477-58966499 CAGTGTGTGGAGTGGGAATCAGG - Intronic
1083248510 11:61449290-61449312 CAGTGAACCCTCTGGGAATGAGG + Intronic
1083314595 11:61806604-61806626 GAGGGAATGCTGAGGGAATGAGG - Intronic
1085315942 11:75545011-75545033 CAGTGTGTGGTGGTGGAATGGGG + Intergenic
1085610675 11:77945832-77945854 GACTGTGTGCTGTGGGACTGTGG - Intronic
1086127483 11:83364179-83364201 CATTGTATGCACTGGGAATATGG + Intergenic
1086632047 11:89032709-89032731 CACTATTTGCTGTGGAAATGAGG - Intronic
1087709195 11:101530179-101530201 CAGGGTCTGCTATGGGACTGAGG - Intronic
1089750993 11:120651046-120651068 CAGGGAAAGCTTTGGGAATGGGG + Intronic
1090128548 11:124115817-124115839 TAGTGTAAGCTGAGGAAATGAGG + Intronic
1090716429 11:129435917-129435939 CAATGTCTGCTATGGGCATGTGG - Intronic
1091288322 11:134421673-134421695 CAGAGTATTCTGTAGGAGTGTGG - Intergenic
1091797304 12:3304598-3304620 CTGTCTCTGGTGTGGGAATGGGG + Intergenic
1097086367 12:56471306-56471328 CTCTGTCTGCTGAGGGAATGGGG + Exonic
1099186363 12:79519839-79519861 CAGAGGATGCTATGGGAATAGGG + Intergenic
1100882923 12:99038501-99038523 CTTTGGCTGCTGTGGGAATGGGG - Intronic
1102205508 12:111088111-111088133 CAGGGAATGGAGTGGGAATGGGG + Intronic
1103102226 12:118188056-118188078 GAATATATGATGTGGGAATGAGG + Intronic
1103823990 12:123721385-123721407 CAGGGTACTCTGTGGGCATGAGG + Intronic
1104238394 12:126961696-126961718 TTGTGTATGCTGTGGGTATCAGG - Intergenic
1104728375 12:131091938-131091960 CTGTGTTTGCTGTATGAATGAGG + Intronic
1106110282 13:26771241-26771263 CAGTGGATGAGGTGGGATTGTGG - Intergenic
1106623536 13:31395081-31395103 AAGTATATGGTGTGGGAAAGAGG + Intergenic
1107032763 13:35870160-35870182 CAGGCCATGCTGTGGGAAGGAGG + Intronic
1110111435 13:71751156-71751178 CAGTGAATGCTCTGGGGATCAGG - Intronic
1110363524 13:74656031-74656053 AAGTGTATGAATTGGGAATGAGG - Intergenic
1111000748 13:82177189-82177211 CAGAGAAGGGTGTGGGAATGGGG + Intergenic
1113005589 13:105698446-105698468 CAGTGTGCTCTGTGGGAATATGG - Intergenic
1113877843 13:113605857-113605879 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877868 13:113605963-113605985 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877879 13:113606004-113606026 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877889 13:113606045-113606067 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877909 13:113606127-113606149 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1113877919 13:113606168-113606190 CAGGGGATCCTGTGGGAAGGCGG + Intronic
1117513046 14:56471945-56471967 CAGAGTTCACTGTGGGAATGTGG + Intergenic
1117902716 14:60551520-60551542 AGGTGTTTGCTGTGGCAATGAGG + Intergenic
1119923404 14:78468853-78468875 CAGTCTTTGGTGTGGGAGTGAGG + Intronic
1120749732 14:88186507-88186529 AAGTGTATGTTGGGGGAATGAGG - Intronic
1121481609 14:94281751-94281773 CAGTGTATGTGGTGGGAAGAAGG + Exonic
1121539111 14:94711770-94711792 CAGTGAATGGTGGTGGAATGAGG - Intergenic
1122970802 14:105151428-105151450 CAGTGTGAGCCGTGGGAATAAGG + Intronic
1123151104 14:106182587-106182609 TAGTGTTTGCTTTGGGGATGAGG + Intergenic
1124370049 15:29099386-29099408 CAGTGTGTCCTGTGTGACTGCGG - Intronic
1126676264 15:51161494-51161516 CAGTGTGAGTTGTGGGACTGAGG - Intergenic
1127153558 15:56104767-56104789 CAGGATTTGCTGTGGGAATAGGG - Intronic
1127350229 15:58144299-58144321 TGGTGTATGATGTGGGATTGGGG + Intronic
1128794556 15:70455782-70455804 CAGTGTATGTTGGGGGGGTGGGG - Intergenic
1129007211 15:72383921-72383943 AACTGGGTGCTGTGGGAATGGGG + Intergenic
1132012832 15:98290999-98291021 TTGTGTGTGCTGTGGGGATGGGG + Intergenic
1133488006 16:6239116-6239138 CAGTGTATGCTGTGGGAATGGGG - Intronic
1133912041 16:10075039-10075061 CAGTGTAGGCATTGAGAATGTGG + Intronic
1134332387 16:13263093-13263115 GAGTGAAGGCTCTGGGAATGGGG - Intergenic
1134671665 16:16060272-16060294 GGGTGTCTGCTGTGGGCATGAGG - Intronic
1137938417 16:52657807-52657829 TAGTGTTTGCAGTGGCAATGGGG - Intergenic
1138311091 16:56024591-56024613 CAGAGTGTGGTGTGTGAATGAGG - Intergenic
1141767184 16:86066417-86066439 CAGAGTGTGCGTTGGGAATGTGG + Intergenic
1142652220 17:1361930-1361952 CAGTGTTAGCTGCTGGAATGAGG + Exonic
1143594332 17:7905532-7905554 TTGTGTATCTTGTGGGAATGGGG + Intronic
1144603999 17:16647800-16647822 CAGTGTTTGGTGGGGGGATGTGG + Intronic
1144729104 17:17516642-17516664 CCGTGTGTGCTTTGGGGATGGGG + Intronic
1145758774 17:27412728-27412750 CAGTGTTAGCTGCTGGAATGAGG + Intergenic
1146163834 17:30573412-30573434 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1147350693 17:39840858-39840880 CAGGGTAGGCAGTGTGAATGAGG + Intronic
1147580844 17:41626266-41626288 CAGTGTGGGCTGAGGGACTGGGG - Intergenic
1150914695 17:69424676-69424698 GAGTGTATTCTGTAGGAATTTGG + Intronic
1151532714 17:74717271-74717293 CAGTGTATGGAATGGGAATCTGG + Intronic
1152047170 17:77944779-77944801 CAGTTGATGCACTGGGAATGAGG - Intergenic
1152523689 17:80875451-80875473 CAGTGTGTGGTGAGGGAAGGGGG + Intronic
1156945220 18:42821403-42821425 CAGTTCATGCTGTGAAAATGTGG + Intronic
1157016021 18:43714513-43714535 CATTGTAGGCTGTTGGCATGGGG + Intergenic
1160276654 18:77443543-77443565 CAGTGTATACTGTGGGAAATGGG - Intergenic
1160378970 18:78435160-78435182 CATTGCATGCTGTGGGGATTTGG - Intergenic
1160471802 18:79141829-79141851 AAGTGTAGGCTGTTAGAATGTGG + Intronic
1161281778 19:3449424-3449446 CAGTGTCTGGGGTTGGAATGGGG - Intronic
1162069604 19:8145906-8145928 CAGTGTGAGCTGTATGAATGGGG - Exonic
1165951615 19:39476713-39476735 GTGTGTATGCCGTGGGAATGAGG + Intergenic
1166476822 19:43133710-43133732 CAGTGTATGGTATGGGAGAGGGG + Intronic
1166546702 19:43638644-43638666 CAGTGTGTGATGAGGGTATGTGG + Intronic
1168147871 19:54429811-54429833 CACTGGGTGCTGTGGGAGTGTGG + Intronic
1168394521 19:56037085-56037107 CAGTTTATGCCCTGGAAATGAGG - Intronic
925995042 2:9285349-9285371 CAGTGTTTGAAGTGGGGATGGGG - Intronic
926761877 2:16285322-16285344 CAGCCTATGCTGGGGGAACGTGG - Intergenic
927468934 2:23357789-23357811 CAGTTTATGCTGTGGCCAAGTGG + Intergenic
929489079 2:42380598-42380620 GAGTGTATTGGGTGGGAATGTGG + Intronic
929794262 2:45047003-45047025 GAGTGATTGCTGTGGGTATGGGG + Intergenic
931228086 2:60351351-60351373 CATTGTGTGCTATGGGGATGAGG + Intergenic
932470178 2:71949870-71949892 CAGTGTGTCCTGTGGGTTTGGGG - Intergenic
933187313 2:79292233-79292255 CAGTGTTGGCTGTGGCAGTGAGG + Intronic
935107723 2:100061220-100061242 CAGCCCATGCTGTAGGAATGAGG + Intronic
940176276 2:150880948-150880970 CAGTGCCTTCTGTGAGAATGTGG + Intergenic
940432187 2:153605899-153605921 CAGTGTCTGCTGTGGACATCAGG + Intergenic
940715079 2:157213230-157213252 CAGTATATTCTCTGGGAAAGGGG - Intergenic
940900142 2:159119242-159119264 CACTGTAATGTGTGGGAATGTGG + Intronic
943060366 2:183037523-183037545 CATTTTTTGGTGTGGGAATGTGG - Intronic
946761201 2:222994923-222994945 CAGGGTTTTCTGAGGGAATGTGG + Intergenic
947136715 2:226983331-226983353 CTGTGTTTTCTGCGGGAATGTGG + Intronic
947252023 2:228117635-228117657 AAGTGAATTCTGTAGGAATGTGG - Intronic
947709117 2:232300626-232300648 CAGTCTATGATGTGGAAAGGAGG - Intronic
948172806 2:235919106-235919128 CAGGGTCAGCTGTGGGAAAGAGG + Intronic
948354450 2:237366850-237366872 AAGTGTTTGCTGTTGGAGTGAGG - Exonic
1168904162 20:1390784-1390806 CAGTCTATTCTGTGAGCATGAGG + Intronic
1170703150 20:18722226-18722248 CACTGTAGTCTGTGGGCATGGGG + Intronic
1172425785 20:34854992-34855014 CAGTGTGTGATGGTGGAATGTGG - Intronic
1172642731 20:36450736-36450758 CAGTGTATGCTGTGTGGTTGGGG - Intronic
1173858757 20:46268508-46268530 CCGTGTGTGGGGTGGGAATGGGG - Intronic
1174538260 20:51269527-51269549 CAGCGTGTGCTGTGAGAATGGGG - Intergenic
1175591158 20:60193259-60193281 CAGTGTATCTGGTGGGAATCAGG + Intergenic
1175873944 20:62220679-62220701 CGGTGCATGTTTTGGGAATGTGG + Intergenic
1178683009 21:34689021-34689043 CAGTGTGGGGTGAGGGAATGAGG + Intronic
1181028896 22:20140655-20140677 CCGAGGCTGCTGTGGGAATGTGG + Exonic
1181628314 22:24136090-24136112 CAGTTTCTGCTGTGGGGAGGTGG - Intronic
1181939486 22:26464249-26464271 GAGGGTCTGCTCTGGGAATGGGG + Exonic
1183148668 22:36019192-36019214 CAGTGTCTGCAGGGGGGATGTGG - Intronic
1185119351 22:48956683-48956705 CTGTGTATGCTGTGTGTGTGTGG - Intergenic
949268281 3:2185550-2185572 CAGTGTATGCTATGGGGATGAGG + Intronic
949385473 3:3497309-3497331 CAGTTCATGCTGTGAGTATGTGG - Intergenic
949732864 3:7133929-7133951 CATTGAATGCTGTGGGAATATGG + Intronic
951448537 3:22810774-22810796 CAGTGAAAGCTATGTGAATGTGG + Intergenic
952138914 3:30456514-30456536 CAGTTTATTCTGGGGGAAAGAGG - Intergenic
960161541 3:114355509-114355531 CATTGTGTGCTGGAGGAATGAGG - Intronic
960221512 3:115115851-115115873 CAGTGTATGGTGTGCGATGGTGG - Intronic
961446778 3:126984696-126984718 CAGTGTGTGCTCTGGGGGTGGGG + Intergenic
962843538 3:139255864-139255886 AAGTGTTTGCAGTGGGAGTGAGG + Intronic
963300410 3:143591349-143591371 CACTGAAATCTGTGGGAATGAGG - Intronic
966111475 3:176407740-176407762 CAGTGTTTGCTGAAGGAATGAGG - Intergenic
966868428 3:184275360-184275382 CAGTGTAGGCTGTGTGTGTGTGG + Intronic
969427158 4:7131741-7131763 CAGTGTAGTGTGTGTGAATGTGG + Intergenic
969852943 4:9976546-9976568 AAATGTATGCTCTGGGAATGTGG - Intronic
971124568 4:23739308-23739330 ATGTGTATGTTGTGGGAAGGAGG - Intergenic
971167505 4:24199119-24199141 ACGTGTATGGGGTGGGAATGGGG - Intergenic
973049032 4:45571969-45571991 CAGTGTATGTCGGGGGAGTGGGG + Intergenic
974394416 4:61316133-61316155 CAGAGAATGATTTGGGAATGAGG + Intronic
975893856 4:79062432-79062454 CAATGTGAGGTGTGGGAATGGGG - Intergenic
978459899 4:108940306-108940328 CAGTGTATTCAGTGGTAAAGAGG + Intronic
978770218 4:112448394-112448416 CAGAGTGTGCAATGGGAATGGGG - Intergenic
979191085 4:117859582-117859604 TTGTGTATTTTGTGGGAATGTGG + Intergenic
982128744 4:152207660-152207682 CAGTGCAGGCTGTGGGAATTAGG + Intergenic
987598099 5:20027626-20027648 CAGTGTTTTCTCTGGTAATGAGG + Intronic
989495483 5:42107190-42107212 CAGAATATGCTGTGGAAATGAGG + Intergenic
989553089 5:42758354-42758376 CAATGTATGGTGTGTGAAAGCGG - Intronic
990433473 5:55762389-55762411 GATAGTATGCTGTGGGAATGTGG + Intronic
990515061 5:56523211-56523233 CATTCTAGCCTGTGGGAATGTGG + Intronic
992720898 5:79560282-79560304 GAGGGTAGGCTCTGGGAATGGGG + Intergenic
993145770 5:84091614-84091636 CAGTGTCTGCTGTGGACATAAGG + Intronic
995179608 5:109218708-109218730 CATTATATGCTGTGGGCATCTGG - Intergenic
997098381 5:130939773-130939795 CAGTGGAAGCTGTTGGCATGGGG - Intergenic
997380292 5:133431118-133431140 CACTGTCTGCTGGGGGAATGGGG - Intronic
998529571 5:142872141-142872163 CAGTGTATGCTGAATAAATGTGG - Intronic
998532978 5:142902403-142902425 GAGTGTGTGTTCTGGGAATGGGG + Intronic
999117248 5:149174671-149174693 CAGTGTATCCTGAAGGAAAGAGG - Intronic
999299448 5:150482083-150482105 AAGAGTAACCTGTGGGAATGTGG - Intergenic
999798677 5:155012014-155012036 AAGTGGTTGCTGGGGGAATGGGG - Intergenic
999897549 5:156051844-156051866 TAGTGTGTGCTGGGGGAAAGAGG + Intronic
1001877890 5:175216843-175216865 CAGTGGAGGCTGGGTGAATGGGG + Intergenic
1002954724 6:1850921-1850943 CCGTCTCTGCTGTGGGAATTAGG + Intronic
1002978320 6:2109233-2109255 CAGTGAATGCAGTGGGCATGGGG - Intronic
1007297290 6:40834529-40834551 CAGTTTATGTTGAGGAAATGGGG + Intergenic
1008290090 6:49704972-49704994 CAGTGTAAGCTGTGGTAGTATGG + Intronic
1008405120 6:51110604-51110626 CAGTGTTTTCTTTGAGAATGTGG + Intergenic
1009010950 6:57841616-57841638 CAGTAAAGGGTGTGGGAATGTGG - Intergenic
1010955814 6:82089642-82089664 CAGTCTGTGCTGTGAGTATGAGG - Intergenic
1011323431 6:86122307-86122329 CAGTGTGTTGTGTGGTAATGGGG + Intergenic
1012598688 6:101069411-101069433 CAGTGTATGCTAAGGAAATGGGG - Intergenic
1014504855 6:122242703-122242725 CAGGATATGCTGTGGGATGGAGG - Intergenic
1015924329 6:138294218-138294240 GAGTGTAAGCAATGGGAATGTGG - Intronic
1017331067 6:153198679-153198701 CAGTGAATTCCGTGGGCATGAGG - Intergenic
1019441212 7:1048127-1048149 CAGTGTTTGCTGAGAGAACGAGG + Intronic
1020623537 7:10548320-10548342 CAGTTTTTGCTGTTGGAAGGGGG - Intergenic
1020790226 7:12618090-12618112 CAGGGAATGCTGTGGCAGTGGGG - Intronic
1021593653 7:22292072-22292094 CAATGTATGCTGTGGACAGGGGG + Intronic
1021765111 7:23941145-23941167 CAGTGTATCCTGTGGGGTTAGGG + Intergenic
1024248413 7:47488268-47488290 CAGTGTCAGCACTGGGAATGAGG - Intronic
1024778410 7:52816402-52816424 CAGGGTGTGCTGTGGGACTGAGG - Intergenic
1025145272 7:56496215-56496237 CAGTGTGTCCTGTGGTCATGAGG - Intergenic
1025152366 7:56568598-56568620 CAGTGTTAGCTGCTGGAATGAGG + Intergenic
1025260876 7:57416714-57416736 CAGTGTGTCCTGTGGTCATGAGG - Intergenic
1025764834 7:64434185-64434207 CAGTGTTAGCTGCTGGAATGAGG - Intergenic
1025842431 7:65163222-65163244 GACTGTGTGCTGTGGGACTGTGG + Intergenic
1025880614 7:65532747-65532769 GACTGTGTGCTGTGGGACTGTGG - Intergenic
1025892823 7:65669857-65669879 GACTGTGTGCTGTGGGACTGTGG + Intergenic
1028057411 7:86263527-86263549 CATTGGATGCTGTGGGAATGAGG + Intergenic
1030219403 7:107081289-107081311 CAGTTTATGATGAGGGACTGAGG - Intronic
1030812281 7:113989338-113989360 CAGGATATGCTGTGGGATGGGGG - Intronic
1032513873 7:132492927-132492949 CAGTGCATGCTGTGGTCAAGAGG - Intronic
1034090855 7:148362743-148362765 CAGTCTATGCTTTGGCAAGGAGG + Intronic
1034968784 7:155407042-155407064 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968808 7:155407117-155407139 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1034968843 7:155407241-155407263 GAGTGTGGGCTGTGGGAGTGTGG + Intergenic
1035926278 8:3731224-3731246 CATTGTTTGCTGGGGGAAGGAGG - Intronic
1036076950 8:5512751-5512773 CTGTGTGTGCTGTGGCAATGTGG + Intergenic
1036697524 8:10987595-10987617 CAGAATACACTGTGGGAATGTGG - Intronic
1036761446 8:11511916-11511938 CAGTGGATGCTGTCGGGAGGTGG + Intronic
1037567673 8:20131066-20131088 CAGTGTCTGCTGTGGGTCTTAGG - Intergenic
1038569327 8:28646917-28646939 TAGTGTATGCTGAATGAATGGGG - Intronic
1039246339 8:35612968-35612990 GAGTGAATGCTGTGGGTTTGTGG + Intronic
1040068827 8:43172627-43172649 AAGTTTCTGCTGTGGGACTGAGG + Intronic
1040818264 8:51531380-51531402 CAGTATATGCTGTGGGCAGTGGG - Intronic
1046355605 8:113081464-113081486 AGGTGTATATTGTGGGAATGTGG - Intronic
1047607345 8:126488396-126488418 CTGTGGCTGCTGTGGGGATGAGG + Intergenic
1047705905 8:127499408-127499430 CAGTCACAGCTGTGGGAATGAGG + Intergenic
1048306423 8:133287756-133287778 GGGTGTATGCTGTGGGCATGTGG - Intronic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1052113962 9:24625951-24625973 CAGTGTATACAGTTGGAAAGGGG + Intergenic
1052584959 9:30415011-30415033 CAGGATGTGCTGTGGGAAGGAGG + Intergenic
1055763061 9:79630776-79630798 CAGTACATGCTGTGTGAATGTGG + Intronic
1056390252 9:86134550-86134572 CAGTAGCTGCTGTGGGAATGTGG - Intergenic
1056777911 9:89527269-89527291 CCTTGTGTGCTGTGGGACTGAGG + Intergenic
1057015123 9:91644589-91644611 CAGTGGAGGCTGGGGGACTGTGG + Intronic
1057216209 9:93230254-93230276 CAGTCTGTACTGTGGGGATGAGG + Intronic
1058461634 9:105189252-105189274 GAGTCTATGCTGTGGGACAGGGG + Intergenic
1060280008 9:122209454-122209476 CAGTGACTGCTGTGGGGGTGCGG + Intronic
1060407945 9:123381969-123381991 GAGTGGTGGCTGTGGGAATGGGG + Exonic
1186838021 X:13457266-13457288 CAGGGAGTGCTGTGGCAATGCGG - Intergenic
1187107628 X:16260609-16260631 CAGGGTGTGCTATGGGAATGTGG + Intergenic
1187263425 X:17708596-17708618 TGGTGTATGGTGTTGGAATGGGG + Intronic
1187527385 X:20066375-20066397 CAGTGTAGGCAGTGGGAATGAGG + Intronic
1190602657 X:52108461-52108483 CAGTGCTTGCTGTGGGCCTGGGG - Intergenic
1192100637 X:68260849-68260871 CAGTGCTTGCTCTGGGAAAGAGG - Intronic
1192639585 X:72849110-72849132 CAGTGTATGCTCTGCGTAAGTGG + Intergenic
1192642126 X:72871695-72871717 CAGTGTATGCTCTGCGTAAGTGG - Intergenic
1193352268 X:80477370-80477392 CAGTGCATGCAGAGGGACTGTGG + Intergenic
1196030072 X:111087173-111087195 CAGGGTTTGCTGTGGGAGAGAGG + Intronic
1197476634 X:126933292-126933314 CGCTGTATGCTTTAGGAATGGGG + Intergenic
1197839272 X:130728166-130728188 CTGTGTGTGCTGTGGGAACTGGG - Intronic
1198861855 X:141079469-141079491 CAGTGGAGGTTGTGGAAATGTGG - Intergenic
1198900835 X:141507903-141507925 CAGTGGAGGTTGTGGAAATGTGG + Intergenic
1199189157 X:144950442-144950464 TAGTATATGCTGTGGGTATTAGG + Intergenic
1199451190 X:147980909-147980931 CAGTGTGCACTCTGGGAATGAGG + Intergenic