ID: 1133488904

View in Genome Browser
Species Human (GRCh38)
Location 16:6248222-6248244
Sequence TTGGAGGCCTAGAATTAGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 198}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133488904 Original CRISPR TTGGAGGCCTAGAATTAGAA TGG Intronic
901820188 1:11824127-11824149 TTGTGGGCCAAGAATCAGAATGG + Intronic
902163526 1:14551602-14551624 TGGGAGGCCTTGACCTAGAAAGG - Intergenic
904763599 1:32823643-32823665 ATAGAGTTCTAGAATTAGAAGGG - Intronic
905657351 1:39693171-39693193 TGGGAGGCCCAGAATGAGAAGGG - Intronic
906834305 1:49066569-49066591 TTGGAGGCCTTGAGTTGGACTGG - Intronic
909584467 1:77274153-77274175 ATGGAGTACTAGAATAAGAATGG - Intergenic
909882867 1:80902231-80902253 CAGGAGGCTTAGAATTAGCAAGG + Intergenic
910595096 1:88972561-88972583 TTGGTGGCCTAAAATCATAAAGG + Intronic
911483904 1:98481437-98481459 TTGGAATCATAGAATTAGCATGG + Intergenic
914275455 1:146119778-146119800 TTGGAAGCCTAGACATGGAATGG - Intronic
914409501 1:147412394-147412416 TTGGAGCCCAAGAAAGAGAAGGG - Intergenic
915956166 1:160221798-160221820 TTTGAGACCTAGAATTAGGAAGG - Intronic
916661604 1:166926950-166926972 TTGCAGGCTTAGAATTAGCAGGG - Intronic
920576876 1:207067734-207067756 TTCTAGGCTTAGAGTTAGAAGGG + Intronic
920648845 1:207822095-207822117 TTGGAGGCCCCGGGTTAGAAAGG - Intergenic
922066087 1:222145277-222145299 ATGTAGGCCTAGTATTTGAAAGG - Intergenic
922993494 1:229937390-229937412 GTGAATGCCTAGAATTAGGATGG - Intergenic
923710186 1:236382213-236382235 TTGGAGACATAGAAATTGAAGGG - Intronic
923861968 1:237900318-237900340 TTGGAGGCATTGATTTAGAAAGG - Intergenic
1066823789 10:39534643-39534665 TTGGAGGCCTATAGTGAAAAAGG + Intergenic
1066824160 10:39542804-39542826 TTGGAGGCCTATAGTGAAAAAGG + Intergenic
1066934799 10:41815064-41815086 ATGGAGGCCTATGGTTAGAAAGG - Intergenic
1070114667 10:73516912-73516934 AAGGAGGCTTAGAATCAGAAGGG + Exonic
1071958878 10:90788488-90788510 TCGGAGACCAAGAATTAGAATGG + Intronic
1073938911 10:108670743-108670765 GTAGAGCCCTAGAATTAAAATGG - Intergenic
1077336850 11:2009127-2009149 TTGGAGGCCTGGAGTTTTAATGG + Intergenic
1078943299 11:16033513-16033535 TTGGTGGTCTGGAATAAGAAAGG + Intronic
1081199332 11:40197618-40197640 ATGGAGTTCTAGAATTTGAATGG - Intronic
1082154584 11:48790698-48790720 TTTGAGGCCTATAATTGAAAAGG - Intergenic
1082296728 11:50449089-50449111 TTTGAGGCCTATAGTGAGAAAGG + Intergenic
1082581748 11:54878813-54878835 ATGGAGGCCTACAGTTAAAAAGG - Intergenic
1082587780 11:54963677-54963699 TTTGAGGCCTATAATGAAAAAGG + Intergenic
1084003955 11:66313591-66313613 TTGGGGGCCTCTAATTAGGACGG - Intergenic
1085881184 11:80468161-80468183 TTGGAAAACTAGGATTAGAAAGG + Intergenic
1088022631 11:105138165-105138187 TAGGAGGCCTAGAAATACAAAGG + Intronic
1088521566 11:110707057-110707079 TTGGACCCAGAGAATTAGAAAGG + Intronic
1091215603 11:133899531-133899553 TTGGAGGCTGAGGAATAGAATGG + Intergenic
1202819834 11_KI270721v1_random:64309-64331 TTGGAGGCCTGGAGTTTTAATGG + Intergenic
1091786108 12:3244303-3244325 TTGGAGGTCCAGAAAAAGAAGGG - Intronic
1093012064 12:14117855-14117877 TTGGAGTCCCAGAAGGAGAAGGG + Intergenic
1095059774 12:37669767-37669789 TTTGAGGCCTATGGTTAGAAAGG - Intergenic
1095066278 12:37779360-37779382 TTTGAGGCCTAGGCTTAAAAAGG + Intergenic
1095254266 12:40015593-40015615 TTGGAAGCCTGGGGTTAGAAAGG - Intronic
1095939247 12:47715426-47715448 TTGGAGGTCTAGACTGAGCAAGG - Intronic
1098414976 12:70223138-70223160 TTGGAGGACTTGAAGTAGAGAGG - Intergenic
1098692665 12:73507824-73507846 TAGCAGGCCTTGAAATAGAAAGG + Intergenic
1099378266 12:81921114-81921136 TTGGAGTATTAGAACTAGAAAGG + Intergenic
1101186352 12:102284699-102284721 TTGGAGGCTTGGAACTAGAGTGG + Intergenic
1103037931 12:117671575-117671597 TGGAAGGCAAAGAATTAGAAGGG - Intronic
1105145130 13:17173430-17173452 TTTCAGGTCTATAATTAGAAAGG + Intergenic
1105600658 13:21884141-21884163 TTGGTGGCTTGGAATCAGAAAGG + Intergenic
1106663427 13:31826395-31826417 TTGGAGGCCAAGAACTTCAAGGG - Intergenic
1107692710 13:42968027-42968049 TTTTAGGCCTAGAATTAGCTAGG + Intronic
1107723547 13:43274921-43274943 TTGGAGCCCTAGAATAAGTGAGG + Intronic
1107844760 13:44500345-44500367 TTGGAGGCCCAGAAACAGACTGG - Intronic
1110564057 13:76940368-76940390 ATGGAGGCCTAAAAATACAAGGG + Intergenic
1112711408 13:102133185-102133207 GTGCAGACCTAGAATTATAATGG - Intronic
1113996084 14:16073989-16074011 TTTGAGGCCTATCGTTAGAAGGG + Intergenic
1113998586 14:16120115-16120137 TTTGAGGCCTAGGTTTAAAAAGG + Intergenic
1114281217 14:21193787-21193809 TTGGATGGCTAAAAATAGAATGG + Intergenic
1114706123 14:24728043-24728065 TTGGAGTACCAGAATTAGATGGG + Intergenic
1114876885 14:26731397-26731419 ATGGAGGCCTAGTCTTAGGAGGG + Intergenic
1116110657 14:40576453-40576475 TTGTAGGCCCAGAATTACAGTGG + Intergenic
1117074136 14:52084356-52084378 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1118105617 14:62656193-62656215 TTGGAGGCCTAAAATAGGTAAGG - Intergenic
1118312121 14:64701888-64701910 TTGGCAGCCAAGAATTAGGAAGG + Intergenic
1118657093 14:67964240-67964262 TTGAACTCCTAGAGTTAGAAAGG + Intronic
1118744645 14:68765048-68765070 TTGGTGGCTTACAATAAGAAAGG - Intergenic
1120033109 14:79665064-79665086 TTGTAGGCCAAGACTTTGAATGG + Intronic
1121557320 14:94848260-94848282 TTGGAGGATGAGAATGAGAACGG + Intergenic
1122589064 14:102832797-102832819 TTGGTACCCTAGAATTAGAACGG + Intronic
1123228431 15:17074330-17074352 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1123228565 15:17077119-17077141 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1124795856 15:32778621-32778643 TAGGACGGCTAGAATCAGAAAGG + Intronic
1126552838 15:49952311-49952333 TTGGAGGACCAGAAGGAGAAGGG - Intronic
1127925561 15:63537345-63537367 AAGGAGGCCTAGAAGTTGAAAGG - Intronic
1129591472 15:76918724-76918746 TAGGATGCCTAGAATTAAAGTGG - Intergenic
1131196573 15:90360166-90360188 AGCAAGGCCTAGAATTAGAAGGG + Exonic
1133488904 16:6248222-6248244 TTGGAGGCCTAGAATTAGAATGG + Intronic
1136914676 16:34174952-34174974 TTTGAGGCCTATCATTAGAAGGG + Intergenic
1137069165 16:35884112-35884134 TTGGCCACCTAGAAATAGAATGG + Intergenic
1137095623 16:36251728-36251750 TTTGAGGCCTAGGATGAAAAAGG - Intergenic
1141614842 16:85204593-85204615 TAGGATGGCTAGAATCAGAAAGG - Intergenic
1143545464 17:7592719-7592741 ATGGAGGCCTGGAATCAGATGGG - Exonic
1144770182 17:17755357-17755379 GTGTAGGCCTAGAGTTAGGAGGG + Intronic
1147643406 17:42018999-42019021 TTGGAAGCCAAGAGTGAGAATGG - Intronic
1148683744 17:49489111-49489133 AGGGAGGCCTAGAACAAGAAAGG + Intergenic
1203194556 17_KI270729v1_random:219635-219657 TTGAAGGAATAGAAATAGAATGG + Intergenic
1203203914 17_KI270730v1_random:19041-19063 TTGAAGGAATAGAAATAGAATGG + Intergenic
1154059990 18:11050746-11050768 TTGGAGAGGCAGAATTAGAAAGG - Intronic
1155160695 18:23193069-23193091 TTGGAGGCCTAGAGTTGGGTGGG + Intronic
1159068988 18:63601872-63601894 ATAGAGCCTTAGAATTAGAAAGG - Intronic
1159252979 18:65905972-65905994 TTTGAAGCCTAAAATTAGAAAGG - Intergenic
1159877448 18:73828205-73828227 TTGTAGGCTTATGATTAGAATGG + Intergenic
1160252452 18:77214973-77214995 TTGGATGGCTAAAATCAGAAAGG - Intergenic
1161544553 19:4872380-4872402 TAGGAGTCCTAGAATTGGGAGGG - Intergenic
1162086743 19:8253980-8254002 TTGGAGGCCCAGAGTCAGAAAGG - Intronic
1164338546 19:24360312-24360334 TTTGAGGCCTATAATGAAAAAGG + Intergenic
1164354227 19:27398460-27398482 TTTGAGGCCTATAATTGAAAAGG - Intergenic
1168094656 19:54107811-54107833 TTGGAGGCCTAGGATCAGGCAGG - Intronic
925526192 2:4805024-4805046 ATGTAGGCCTAGGATTATAAAGG - Intergenic
926652980 2:15366754-15366776 TTGGATGCCTTGCATTAGGAAGG - Intronic
927092426 2:19722255-19722277 TTGGAAGCCTAGTTTTATAAGGG + Intergenic
929921258 2:46173130-46173152 GTGCAGCCCTAGAATAAGAATGG + Intronic
929926076 2:46210914-46210936 TTGGAGTCCTAGAAGAAGAAGGG - Intergenic
930607599 2:53508752-53508774 TTGGAGGCTTCTAATTAGAAAGG - Intergenic
935821097 2:106893634-106893656 TTGGAGACCTAGAAATATACTGG - Intergenic
936551643 2:113447850-113447872 TAAGAGAACTAGAATTAGAAGGG - Intronic
942081932 2:172408444-172408466 TTGTGGACCTATAATTAGAAGGG - Intergenic
942264563 2:174208961-174208983 TTAGAGGCCTCAAAATAGAAAGG - Intronic
943692622 2:190883369-190883391 TTGCAGGCTAAGCATTAGAAAGG - Intronic
943930905 2:193851676-193851698 TTGGAGGTATAGAATTCAAAAGG + Intergenic
945833408 2:214811271-214811293 TTGGAGGTTTTGAACTAGAAGGG - Intergenic
947236716 2:227949034-227949056 TTGGAGGGCTAGAAGAAGACAGG + Intergenic
1169227177 20:3864142-3864164 TTGGAGGCCTAGACACAGTAGGG + Intronic
1171576234 20:26323153-26323175 TTGGAGGCCTATGATGAAAAAGG + Intergenic
1171742314 20:28913363-28913385 TTTGAGGCTTATCATTAGAAGGG + Intergenic
1171763219 20:29232029-29232051 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1171764091 20:29243212-29243234 TTTGAGGCCTACAGTTAAAAAGG - Intergenic
1171909851 20:30939105-30939127 TTAGAGGCCTATATTTGGAAAGG - Intergenic
1175038932 20:56027347-56027369 TTGGGGGCCTAAAAAAAGAAAGG - Intergenic
1175432645 20:58917463-58917485 TGAGAGACCTAGAATTGGAAGGG + Intergenic
1176325231 21:5390676-5390698 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1176374772 21:6081583-6081605 GAGGAGGCCCTGAATTAGAAAGG + Intergenic
1176482787 21:7321092-7321114 TTTGAGGCCTATCATTAGAAGGG - Intergenic
1176531058 21:7958368-7958390 TTGGAGGCCAATAGTGAGAAAGG + Intergenic
1176531616 21:7967783-7967805 TTTGAGGCCTAGGTTTAAAAAGG + Intergenic
1176761942 21:10807134-10807156 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1178314249 21:31556087-31556109 TTGGGGGCCTAGACTTAAAAGGG - Intronic
1179060469 21:37974561-37974583 TAGGAGGCCCAGAACCAGAAAGG + Intronic
1179748703 21:43456662-43456684 GAGGAGGCCCTGAATTAGAAAGG - Intergenic
1180310975 22:11233158-11233180 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1180401644 22:12436155-12436177 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1182811086 22:33117179-33117201 TTGGAAGACCAGAATTAGATAGG - Intergenic
1184707581 22:46225003-46225025 TGGGAGGCCTAGAATCAGCCAGG + Intronic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
950643667 3:14364407-14364429 TAGCAGAACTAGAATTAGAACGG - Intergenic
952310372 3:32183538-32183560 TTGGGGGGCTAGAATTAGAGAGG + Intergenic
952493813 3:33898344-33898366 TTGGCTGCCTAGAATAAAAATGG - Intergenic
955588659 3:60510441-60510463 TTCTAGGCCTTGAATTTGAATGG + Intronic
958216527 3:90587954-90587976 TTTGAGGCCTACAATAGGAAAGG - Intergenic
958220787 3:90674387-90674409 TTTGAGGCCTACGGTTAGAAAGG - Intergenic
958225656 3:90814886-90814908 TTTGAGGCCTACAATAGGAAAGG + Intergenic
958233987 3:90955059-90955081 TTTGAGGCCTACAGTAAGAAAGG + Intergenic
958240230 3:91060393-91060415 TTTGAGGCCTACAATGGGAAAGG + Intergenic
958241557 3:91082481-91082503 TTTGAGGCCTACAATAAGAAAGG + Intergenic
958242728 3:91102026-91102048 TTTGAGGCCTACAATAGGAAAGG + Intergenic
959650597 3:108746784-108746806 GGGGAGACATAGAATTAGAATGG + Intronic
960255274 3:115505122-115505144 TTGGAGGGCTAGAAGAAGACAGG + Intergenic
960677703 3:120212638-120212660 TAGGATGGCTAGAATTAAAAAGG + Intronic
963576037 3:147061341-147061363 TTGGAGGAATAAAAATAGAAAGG + Intergenic
964966202 3:162496348-162496370 CTGGAGGCCTAGAAAGAAAATGG - Intergenic
965922604 3:173936493-173936515 TTGGATGGCTAGGATTACAATGG + Intronic
967749763 3:193100664-193100686 TTGGAGGGCTAGAAGAAGATAGG + Intergenic
976337888 4:83911864-83911886 TTGGACACCTATCATTAGAATGG + Intergenic
978312230 4:107397069-107397091 TTGTAGGTCTAGAATTAAAGGGG - Intergenic
978574818 4:110179130-110179152 CTGGAGGCCTAGAATTATGAAGG - Intronic
980089377 4:128426283-128426305 ATGGAGTCCTAGAACTGGAAGGG + Intergenic
982095651 4:151919995-151920017 TAGGAAGCCTAGAACTCGAAAGG + Intergenic
984968645 4:185166076-185166098 TTGAAGGCCAAAAATTAGGAAGG - Intronic
985350657 4:189058096-189058118 TTGGAGGTTAAGAATCAGAATGG + Intergenic
987089983 5:14501843-14501865 GTGGAGGCCTAGAATCACAGTGG + Intronic
987726759 5:21712173-21712195 CTGAAGCACTAGAATTAGAAGGG + Intergenic
989283416 5:39670952-39670974 TTGGAAGATTAGAATTAGATAGG - Intergenic
989842299 5:46093570-46093592 TTTGAGGCCTAGAGTGAAAAAGG + Intergenic
989846772 5:46154459-46154481 TTTGAGGCCTATAATGAAAAAGG + Intergenic
989855799 5:46288736-46288758 ATGGAGGCCTATAATGAAAAAGG - Intergenic
989858362 5:46330532-46330554 TTGGAGGCCTACATTGAAAAAGG - Intergenic
991475417 5:67013394-67013416 TTAGGGTCATAGAATTAGAAGGG + Intronic
992820996 5:80495867-80495889 TAAGAGAACTAGAATTAGAATGG + Intronic
993514191 5:88809912-88809934 CTGGAGGACTACAATGAGAAAGG - Intronic
994810711 5:104515535-104515557 TAGGAGACCTAGATATAGAAAGG + Intergenic
997943939 5:138182748-138182770 TTGGAGGCCTCCATTTAGCAGGG - Exonic
1000179923 5:158798955-158798977 TTAGAGGTCTAAACTTAGAAAGG - Intronic
1000728859 5:164805783-164805805 TTGGAGGATTAGCATTTGAAGGG + Intergenic
1003954820 6:11152218-11152240 TTTGAAGCATAGAATTGGAAAGG + Intergenic
1008952498 6:57175927-57175949 CTGGAGGCCTAGACTTGCAACGG + Intronic
1012691550 6:102319321-102319343 TTGGAGGCTCAGAAGAAGAAAGG + Intergenic
1015614810 6:135063663-135063685 TTGGAGGCAGAGAAGGAGAAAGG + Intronic
1015638370 6:135303643-135303665 TTGGAGGCCCAGAGTTACCAAGG + Intronic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1019069241 6:169328449-169328471 GTAGAGGCCTTGAATTAAAAAGG + Intergenic
1019799890 7:3080493-3080515 TAGAAGGCCTGGATTTAGAAAGG + Intergenic
1019907066 7:4072847-4072869 TTCCAGGCCTCGAATTAAAATGG - Intronic
1022737526 7:33089957-33089979 ATGGAGGCCAAGACTTATAAGGG + Intergenic
1025571654 7:62579464-62579486 TTTGAGGCCTAGCATGAAAAAGG - Intergenic
1026636041 7:72082492-72082514 TTTGAGGACTAGAAACAGAATGG + Intronic
1027656609 7:80938186-80938208 TTAGAATTCTAGAATTAGAAAGG + Intergenic
1027762194 7:82293558-82293580 CTTGAATCCTAGAATTAGAAAGG - Intronic
1029330153 7:99846536-99846558 TTGGACGGCAAGAAATAGAAGGG - Intronic
1035154811 7:156903834-156903856 TTGCAGACCTAGAATTAGGATGG - Intergenic
1035672143 8:1426287-1426309 TTGGAGACCTAAAATTGGGAAGG + Intergenic
1036190749 8:6668723-6668745 TTGGAGACCTTGTCTTAGAATGG - Intergenic
1037353413 8:17990566-17990588 TTCGAGTCCTAGACTTGGAAAGG + Intronic
1037655340 8:20878379-20878401 ATGGAACCCTAGGATTAGAAAGG - Intergenic
1040140830 8:43910088-43910110 TTTGAGGCCTAGGATTGAAAAGG + Intergenic
1040140838 8:43910259-43910281 TTTGAGGCCTAGGATTGGAAAGG + Intergenic
1042740025 8:72032736-72032758 TTGGTGACCTAGAAAAAGAAAGG - Intronic
1046309149 8:112412289-112412311 TTGTAGTCCTAGAAATAAAAGGG - Intronic
1046786199 8:118269520-118269542 ATGGAAGCCTAAAATTAGAAAGG - Intronic
1048278677 8:133088423-133088445 TAGCAGGGCTAGAATTATAAAGG - Intronic
1049901354 9:169282-169304 TAAGAGAACTAGAATTAGAAGGG + Intronic
1053713526 9:40853552-40853574 TTGGAGGCCTACAGTGAAAAAGG + Intergenic
1053744392 9:41179596-41179618 TAAGAGAACTAGAATTAGAAGGG + Intronic
1054349662 9:64009500-64009522 TAAGAGAACTAGAATTAGAAGGG + Intergenic
1054424962 9:65055139-65055161 TTTGAGGCCTATGATGAGAAAGG + Intergenic
1054482880 9:65685620-65685642 TAAGAGAACTAGAATTAGAAGGG - Intronic
1054683953 9:68251654-68251676 TAAGAGAACTAGAATTAGAAGGG - Intronic
1057062567 9:92018687-92018709 ATGGATTCCTAGAATTGGAATGG - Intergenic
1059843413 9:118243766-118243788 TTGGAGGGCTAGAATAAGACAGG - Intergenic
1061337497 9:129950685-129950707 ATGGAGGCCTAGACTTAAAGTGG - Intronic
1062664446 9:137660979-137661001 TCTGAGGCCTGGGATTAGAAAGG - Intronic
1203383001 Un_KI270435v1:78802-78824 TTTGAGGCCTATCGTTAGAAGGG - Intergenic
1203359561 Un_KI270442v1:203178-203200 TTTGAGGCCTACATTTAAAAAGG - Intergenic
1203402551 Un_KI270519v1:125481-125503 TTTGAGGCCTATCGTTAGAACGG - Intergenic
1185828013 X:3271549-3271571 TGAGTGGCCTTGAATTAGAAAGG - Intergenic
1187948616 X:24450643-24450665 TTGTAGACCTAGAAGTGGAATGG - Intergenic
1190988991 X:55526387-55526409 TGGGAGGCCGAGCATTAGTATGG - Intergenic
1192429544 X:71103025-71103047 TTGAAGGCCTGGAATTAGCTTGG + Exonic
1193614205 X:83667913-83667935 CTGGAGGCCTATGATGAGAATGG - Intergenic
1193627413 X:83837976-83837998 TTGATGGCCTAGGAATAGAAAGG - Intergenic
1198489902 X:137129072-137129094 TAAGAGAACTAGAATTAGAAGGG - Intergenic
1201942792 Y:19477794-19477816 CTGGAGGCCAAGAATTATGAGGG - Intergenic