ID: 1133489321

View in Genome Browser
Species Human (GRCh38)
Location 16:6251570-6251592
Sequence CCCCCTACCTCCAAGGGGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133489321 Original CRISPR CCCCCTACCTCCAAGGGGTA GGG (reversed) Intronic
901746666 1:11378258-11378280 ACCCCTACCTCCCAGGGATGGGG - Intergenic
901872236 1:12144941-12144963 CCCCCTGCCTCCCAGGGCTTGGG - Intergenic
902241642 1:15094094-15094116 CCCTCTGCCTCCCGGGGGTATGG + Intronic
902820252 1:18939052-18939074 CCCCTCACCTCCAAGGGGAGAGG - Intronic
903577286 1:24346743-24346765 AAACCTAGCTCCAAGGGGTAAGG - Intronic
903947706 1:26974000-26974022 CCCCCCACCACCCAGGGGTGGGG - Intergenic
908131479 1:61080013-61080035 CCCCCTCCCTCCGCGGGGGAGGG + Intronic
908393427 1:63703800-63703822 CCCCCCACCCCCAAGGGGTTGGG + Intergenic
912450136 1:109763495-109763517 TCCCCTACCCCTAAGGGGCAAGG - Intronic
917428262 1:174938098-174938120 CCCTCTACATCCAAGGGCTTTGG - Intronic
920043139 1:203116711-203116733 CCCCCTATCTGCAAGGGGGTGGG - Intronic
920278885 1:204828768-204828790 TCGCCTACCTCCAAGGGCTCGGG - Exonic
920531676 1:206706880-206706902 CCTTCTAGCCCCAAGGGGTAGGG - Intronic
1067146902 10:43700912-43700934 CCCACTACCCCCAAGGGGCTCGG + Intergenic
1067686236 10:48467327-48467349 CCCCATACTTCCAAAGGGTGAGG + Intronic
1077330851 11:1983274-1983296 CCCCCACTCTCCAAGGGGTCGGG - Intronic
1077414530 11:2418519-2418541 GCCCCTACCTCCAAGGTGTTGGG + Exonic
1078058046 11:8023305-8023327 GCTCCTGCCTCCAAGAGGTAAGG - Intronic
1078584799 11:12574149-12574171 ACACCTACCTCCAAAGGCTAGGG - Intergenic
1080578403 11:33621287-33621309 ACCCTTAGCTCCAAGGGGTTTGG + Intronic
1082802334 11:57424380-57424402 ACCCCTTTCTCCAAGGGGTTGGG - Intronic
1084183661 11:67458925-67458947 CTCCCTACCTCCCAGAGGTCTGG - Exonic
1084326962 11:68406086-68406108 GCTCCTACCTCCAAGGTGAATGG + Intronic
1085747367 11:79126742-79126764 CCCCCTTCATTCAAGGGGTCAGG - Intronic
1089323812 11:117643950-117643972 CCCCCTACCTCAAATGGGCTTGG - Intronic
1089712642 11:120326844-120326866 CCCCCAACCTCCAAGATGTCTGG + Intronic
1090692247 11:129196051-129196073 TCTTCTACCTCCAAGAGGTAGGG + Intronic
1202813831 11_KI270721v1_random:38453-38475 CCCCCACTCTCCAAGGGGTCGGG - Intergenic
1096758173 12:53817310-53817332 CCCCCAACCTCCAAGAGGTGGGG - Intergenic
1096997434 12:55847647-55847669 CCCACTGCCTCCACAGGGTAAGG - Intergenic
1097090919 12:56504078-56504100 GCCTCGACCTCCAAGGGGTTAGG + Intergenic
1100116098 12:91306263-91306285 CCCCCTACCTCCCTGGGGTCTGG - Intergenic
1100537255 12:95522933-95522955 CCCCCAACCCCCAAAGGGAATGG + Intronic
1101546701 12:105720083-105720105 ACCCCTAACTCACAGGGGTACGG - Intergenic
1103145817 12:118595038-118595060 CCCTCAAAGTCCAAGGGGTAAGG - Intergenic
1106487410 13:30184744-30184766 CCCCTTACCTCCAAGGGTGTGGG + Intergenic
1108503236 13:51086794-51086816 CCCCCTCACTCCCAGGGGCAGGG + Intergenic
1109205394 13:59477644-59477666 CCCCTAACCTCCGAGGGGCAAGG + Intergenic
1114535043 14:23417408-23417430 TCCCCCACCTCCAAGGAGGATGG + Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1122392429 14:101399385-101399407 AACCCTACCTCAAAGGGGGAGGG + Intergenic
1122573768 14:102727292-102727314 CCCCCCACCTCCAAGAGGTTCGG + Exonic
1122920958 14:104879929-104879951 CCCCCAGCCTGCAAGGGGCAGGG + Intronic
1125484160 15:40100823-40100845 CTCCATACCTCCAAGGGAGAAGG + Intronic
1128066200 15:64766152-64766174 CCTCCAACCTCCAAGGAGGACGG - Intronic
1128450273 15:67802088-67802110 CCCCCTGCCTCCACGTGGGAGGG + Intronic
1129411150 15:75351009-75351031 CACCCCACCTCCAAGGGTCATGG - Intronic
1133489321 16:6251570-6251592 CCCCCTACCTCCAAGGGGTAGGG - Intronic
1133541768 16:6762751-6762773 CCCCCTATCCCCTTGGGGTAAGG - Intronic
1135937457 16:26793276-26793298 GCCCAGGCCTCCAAGGGGTAGGG + Intergenic
1137492348 16:48943741-48943763 CCTCCTACCTCCAAGGTTAAAGG + Intergenic
1143771223 17:9170219-9170241 CCTCCTCCCTCCTAGGGCTATGG + Intronic
1144371078 17:14592255-14592277 CCACCTAACTCCCAGGGGTCTGG + Intergenic
1148836600 17:50469000-50469022 CCCCCGCCCTCCACGGGGAAGGG + Intronic
1151380866 17:73724873-73724895 CCGCCTCCCTCCATGGGGTCGGG - Intergenic
1158159519 18:54465330-54465352 TCCCCTTCCTGCAAGGGGTGAGG - Intergenic
1160892121 19:1384406-1384428 GCCCTTACCTCCCAGGGGTGGGG - Intronic
1163233641 19:16019291-16019313 CCTCCGCCCTCCCAGGGGTATGG - Intergenic
1163637706 19:18445118-18445140 CCCGCTACTTCCAAGGTGTGGGG - Intronic
1166218716 19:41352493-41352515 CCCCCTACCACCCAGGTGTCTGG - Intronic
1166704901 19:44903264-44903286 CCCCCGACCCCCAAGGGGGGAGG - Exonic
927494490 2:23543435-23543457 CCCCCTACCTACTGGGGGTCAGG - Intronic
932337036 2:70937467-70937489 CCCCCGAGCTCCATGGGGCAGGG - Intronic
933945681 2:87284230-87284252 CCCTCTACCTCCACAGGGTGTGG + Intergenic
936232954 2:110720194-110720216 CCCCCTTCCTCCCAGGTGCAAGG - Intergenic
936334532 2:111577356-111577378 CCCTCTACCTCCACAGGGTGTGG - Intergenic
938812101 2:134863040-134863062 CCCCCTACCTCCCAGGAGGTCGG - Intronic
940377499 2:152972084-152972106 TCCCCTGCCTCACAGGGGTAAGG + Intergenic
942814916 2:180041757-180041779 ACCCCTACCTACAAGGGTTTTGG - Intergenic
945958535 2:216108441-216108463 CTGCCTCCCTCAAAGGGGTAGGG + Intronic
948830671 2:240596950-240596972 CCCCCTCCCTCCCTGGGGCAAGG - Intronic
1168876087 20:1173292-1173314 TCCCCTACCTACAAGGGCTTTGG + Intronic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1172705397 20:36878867-36878889 ACCCCTATCTCCGAGGGCTATGG + Intronic
1172870094 20:38130346-38130368 TCCCCTGCCTCCACGGGGTCTGG + Exonic
1173269640 20:41521010-41521032 CTATCTACCTGCAAGGGGTAGGG + Intronic
1178661494 21:34510908-34510930 CCCCCACCCTCCCAGGGGCAGGG - Intergenic
1179960821 21:44766248-44766270 CCCTCTGCCTCCATGGGGTGCGG - Intergenic
1181667310 22:24407136-24407158 CTCCAAACCTCCAAGGGTTAAGG + Intronic
1181728479 22:24827706-24827728 ACCCCTCCCTCTTAGGGGTAAGG - Intronic
1183094866 22:35545987-35546009 CCTCCCAACTCCAAGGGTTATGG - Intronic
1184172077 22:42765730-42765752 GCCCCTCCCTCCAGGGGGAAGGG - Intergenic
1184680285 22:46069353-46069375 CCCCCCAGCTCCAAGGGCTGTGG - Intronic
1184806003 22:46795324-46795346 CCCCCTACCCCCAAGATGCAGGG + Intronic
1185086698 22:48744720-48744742 CCCCCTGCCTCCCAGGGCTGCGG - Intronic
1185376316 22:50484110-50484132 GTTCCTACCTCCAAGGGGGAGGG + Exonic
962530798 3:136277942-136277964 ACCCATACCTCCCAGGGGCAGGG - Intronic
967122172 3:186391847-186391869 CCCCACACCTCCAAGGGAAATGG - Intergenic
973666112 4:53161134-53161156 CTCCCTCCCTCTAAGGAGTAGGG - Intronic
974885255 4:67809871-67809893 CACCCTACCTCTAAGGGTTCTGG - Intergenic
981745993 4:148052892-148052914 CCCCAGACCCCCAAGAGGTAGGG - Intronic
985129639 4:186726712-186726734 CCCACCGCCTCCAAGGGGGAGGG - Intronic
985855054 5:2417988-2418010 CCCCATACTCCCATGGGGTAAGG - Intergenic
987814692 5:22884926-22884948 CCCCCTACCCCAAAGTTGTATGG + Intergenic
995058741 5:107791117-107791139 CCCCTTACCACCAAGAGGTGAGG - Intergenic
998402641 5:141855958-141855980 CCCCCCACCCCCAAGGGACATGG + Intronic
998583797 5:143404993-143405015 CCCCCTCAGTCCAAGGGGAAGGG + Intronic
1006142303 6:31937257-31937279 CCACCTACCACCTAGGGGTAGGG - Intronic
1006449729 6:34099107-34099129 CCCCCAACCTCCCATGGGCAAGG + Intronic
1006848745 6:37081919-37081941 CCCGCTGCCTCACAGGGGTATGG - Intergenic
1008082569 6:47209705-47209727 CCCCCTACCTCCAGGGCCTTGGG + Intergenic
1023018615 7:35989364-35989386 CCCCCTACCCCGCAGGAGTAGGG + Intergenic
1023319719 7:38981116-38981138 CATCCTACCTTCAAGGGGTTAGG - Intronic
1029950466 7:104578702-104578724 CCCCCTACCCCCAACCAGTAAGG + Intronic
1031944845 7:127828947-127828969 GCCCCTACCTCTAAGAGGTCAGG - Intronic
1037802268 8:22042331-22042353 CCGCCTCCCTCCAGGGGGCAGGG - Intergenic
1039848375 8:41342279-41342301 TCCCCTCCCTCTGAGGGGTAGGG + Intergenic
1040548974 8:48423781-48423803 CCCCCAACCTGCAGGGGGTGTGG - Intergenic
1041292543 8:56320592-56320614 TCCTTTACCTCCAAGGGGCAAGG - Exonic
1043438098 8:80253624-80253646 CACCCTCCCTCCAAGGGGCAGGG + Intergenic
1049455485 8:142684312-142684334 CCCCCTTCCACCAGGGGGTAGGG - Intergenic
1050068597 9:1786949-1786971 CCCTCAACCACAAAGGGGTAAGG - Intergenic
1053388768 9:37717846-37717868 CCCCCTAGATTCAAGAGGTATGG + Intronic
1054730479 9:68697982-68698004 CCACCTACTTGCAAGGGGTCTGG - Intergenic
1054879116 9:70126401-70126423 ACACCTACCTCCATGGGGTAAGG - Exonic
1058671579 9:107364867-107364889 CCCACTACCTCCAAGGCCTCTGG - Intergenic
1058702271 9:107611132-107611154 CCCCCTACTCCCAGGAGGTAAGG - Intergenic
1061779345 9:132986644-132986666 CCCCACACCTGCAAGGGGGAGGG - Exonic
1062067348 9:134535869-134535891 TCCCCTCCCTCTCAGGGGTAGGG - Intergenic
1062352009 9:136143889-136143911 CCAGCTACCTCCAGGGGGTCTGG + Intergenic
1198390229 X:136166921-136166943 CCACCTACCTCATAGAGGTAAGG - Intronic
1198390378 X:136168111-136168133 CCACCTACCTCATAGAGGTAAGG - Intronic
1199848054 X:151705958-151705980 TCCCAAACTTCCAAGGGGTATGG + Intergenic
1200983469 Y:9283237-9283259 CCCCCTACGTCCATGGTGTAAGG - Intergenic
1202126908 Y:21576450-21576472 CCCCCTACATCCATGGTGTAAGG + Intergenic