ID: 1133490015

View in Genome Browser
Species Human (GRCh38)
Location 16:6258744-6258766
Sequence AATAACTAAGAGAGTTTAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2049
Summary {0: 1, 1: 1, 2: 29, 3: 571, 4: 1447}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133490014_1133490015 -7 Left 1133490014 16:6258728-6258750 CCATTGTAGATTTAAAAATAACT 0: 1
1: 0
2: 10
3: 58
4: 671
Right 1133490015 16:6258744-6258766 AATAACTAAGAGAGTTTAGTTGG 0: 1
1: 1
2: 29
3: 571
4: 1447

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133490015 Original CRISPR AATAACTAAGAGAGTTTAGT TGG Intronic
Too many off-targets to display for this crispr