ID: 1133491079

View in Genome Browser
Species Human (GRCh38)
Location 16:6268814-6268836
Sequence TGTTCTCTGTTGGAGGAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 278
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 257}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133491079_1133491086 25 Left 1133491079 16:6268814-6268836 CCCTGTTCCTCCAACAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 257
Right 1133491086 16:6268862-6268884 GTCTTCCCGCAGTATCAGTGGGG 0: 1
1: 0
2: 0
3: 46
4: 237
1133491079_1133491087 26 Left 1133491079 16:6268814-6268836 CCCTGTTCCTCCAACAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 257
Right 1133491087 16:6268863-6268885 TCTTCCCGCAGTATCAGTGGGGG 0: 1
1: 0
2: 1
3: 41
4: 239
1133491079_1133491084 23 Left 1133491079 16:6268814-6268836 CCCTGTTCCTCCAACAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 257
Right 1133491084 16:6268860-6268882 CAGTCTTCCCGCAGTATCAGTGG 0: 1
1: 0
2: 3
3: 43
4: 276
1133491079_1133491085 24 Left 1133491079 16:6268814-6268836 CCCTGTTCCTCCAACAGAGAACA 0: 1
1: 0
2: 0
3: 20
4: 257
Right 1133491085 16:6268861-6268883 AGTCTTCCCGCAGTATCAGTGGG 0: 1
1: 1
2: 2
3: 54
4: 282

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133491079 Original CRISPR TGTTCTCTGTTGGAGGAACA GGG (reversed) Intronic
901331998 1:8417272-8417294 TATTCTCTGCTGCAGGAATATGG + Intronic
902425020 1:16313758-16313780 TGTTCTTTCCTGGGGGAACAAGG - Intronic
904191089 1:28744364-28744386 TGTTCTCTGTTGGATTAACTTGG + Intronic
904858268 1:33516189-33516211 TCTTCTCTGTGTGGGGAACAGGG + Exonic
907728731 1:57045249-57045271 AATTCTCTCTTGGAGGACCATGG + Intronic
907910408 1:58820877-58820899 TGTCCTCTGTTGAAGCAACAGGG + Intergenic
908367809 1:63444342-63444364 TGTTCTCTGTTGGATTTTCATGG + Intronic
909048388 1:70737861-70737883 TGTGCTCAGTGGGAGGAATAGGG + Intergenic
909637584 1:77834180-77834202 TTTTCTTTTTTAGAGGAACAGGG + Intronic
910322629 1:85965813-85965835 TGTAGTATGTTGGAGGAACCAGG + Intronic
910413669 1:86973973-86973995 TGTTCTCTGTGTCAGGAACTGGG - Intronic
913142908 1:115959321-115959343 TGTGCTCTGTTGCAAGAAGATGG - Intergenic
915574859 1:156768553-156768575 TGTTCTCAGTAGGAGGAAAGGGG - Intronic
918039161 1:180901716-180901738 TGTTCTGTGGTGGAGGATCCTGG + Intergenic
920106659 1:203557994-203558016 TGTTCTCTGTTGGAGAGATCTGG + Intergenic
920127576 1:203705721-203705743 TGTACTCTGTAAGAAGAACAAGG - Intronic
920703740 1:208236706-208236728 TCTGCTCTGGTGGTGGAACAGGG - Intronic
920814466 1:209318544-209318566 TGTTCTCTTTTTGAGGATGAGGG - Intergenic
922062661 1:222107033-222107055 GGATCTCTGTTGTAGAAACAAGG - Intergenic
923911074 1:238444732-238444754 TGTTCTCTGCTGGTGGAGCCTGG - Intergenic
1064166842 10:12993982-12994004 TTCTCTCTGTTGGAGGATCTGGG - Intronic
1065633187 10:27703174-27703196 CATTCTCTGTAGGAGGAAAAAGG + Intronic
1068490458 10:57717276-57717298 TGTTCTTTGTTGGTGGAAAGAGG + Intergenic
1068807254 10:61211526-61211548 TGTTCTCAGTTCCAGGCACAAGG - Intergenic
1070524087 10:77280075-77280097 TGTTCTCTATTAGAGGAGGAAGG - Intronic
1070640728 10:78167058-78167080 TGTGTTCTGATGGAGGAAAAAGG + Intergenic
1070730931 10:78827893-78827915 TTTTCTCTGTTGGAAAAACTGGG - Intergenic
1073117238 10:101098147-101098169 TGATCTCTGTGGCAGGAACCAGG + Intronic
1073566928 10:104543079-104543101 TGCTCTCTGTTGGAGGGCCCAGG + Intergenic
1074829236 10:117237055-117237077 TGTTCTCTGTTACTGGAAAATGG - Intergenic
1075210958 10:120490650-120490672 TGTTCCCCCATGGAGGAACAAGG - Intronic
1075571448 10:123549321-123549343 AGTTCCCTGTTGGAGGTTCAAGG - Intergenic
1075912717 10:126139729-126139751 GCTTCTCTGGGGGAGGAACAGGG - Intronic
1077154840 11:1086626-1086648 TGTCCTGTGTGGGAGGCACAGGG + Intergenic
1077517586 11:3011049-3011071 TTTCCTCTTTTGGAGGATCATGG + Intronic
1079244639 11:18743476-18743498 TGAGCTCTGCTGGGGGAACACGG - Intronic
1080975099 11:37329983-37330005 TCATGTCTTTTGGAGGAACATGG - Intergenic
1081197195 11:40176114-40176136 TATTCTCTGGTGGAGGAGGATGG + Intronic
1081931454 11:46874269-46874291 TATTCTCACATGGAGGAACAGGG - Intronic
1083552824 11:63603214-63603236 AGTTCTCTGTTCCAGGATCAAGG + Intronic
1084019521 11:66409350-66409372 TCTCCCCTGTTGGAGGAGCAGGG - Intergenic
1084368232 11:68717684-68717706 TGCTCTCCCTTGGAGGAACCTGG - Intronic
1085872428 11:80366508-80366530 TGTACTCTGTTGTAGGAAACAGG - Intergenic
1086408151 11:86517129-86517151 TGTTCTCTCTTGCAAGCACAAGG + Intronic
1086599499 11:88615481-88615503 CCTTCTCTGGTGGAGGAAGAAGG - Intronic
1086970178 11:93073023-93073045 TGTTCTCTGCAGGAGTAACTGGG - Intergenic
1087266510 11:96067345-96067367 TGTGCTCTGTTGGCGGAAGAAGG - Intronic
1087542178 11:99533666-99533688 TGTTCACTGGTGGGGGTACAGGG + Intronic
1088137320 11:106573262-106573284 TTTTCTCTGTTGGAGAGATAGGG + Intergenic
1089111567 11:116061822-116061844 TGTTCTCTTTTGCTGGAACAAGG + Intergenic
1089431809 11:118431112-118431134 TGTTCTTTGTTGGAGGACTTTGG + Intronic
1090771546 11:129924381-129924403 TATTCTTTGTTGGAGCAAAATGG - Intronic
1092510527 12:9151018-9151040 TGTTCTAAGCTGGAGAAACATGG + Intronic
1092956050 12:13551217-13551239 TGTTCTCAATGGGAGGAATAAGG - Exonic
1093384355 12:18533121-18533143 TATACTCAGTGGGAGGAACAAGG + Intronic
1093762192 12:22923089-22923111 TGTCCTCTGCTCGAGGATCAAGG - Intergenic
1094173502 12:27519378-27519400 TGTTTTATGTTGTAGGAAAAAGG + Intergenic
1094830411 12:34297629-34297651 TTTCCTCTGTGGGAGGAACCAGG - Intergenic
1095291177 12:40481975-40481997 TATCGTCAGTTGGAGGAACAGGG + Exonic
1095465253 12:42483105-42483127 TGTTCTATGCTGGAGGACAAGGG - Intronic
1096431616 12:51548940-51548962 TCTTATCTGTTGGAGAATCAGGG - Intergenic
1097604024 12:61730754-61730776 TGTTGGCTGTTGGGGGAGCATGG - Intronic
1098170921 12:67746493-67746515 AGTTCTTTGTTGGGGGAAGAGGG - Intergenic
1100639778 12:96471311-96471333 TGTACTTTGTTGGAAGAATAGGG + Intergenic
1102732063 12:115120343-115120365 TCATGTCTGTTGCAGGAACATGG + Intergenic
1105043828 12:132985553-132985575 TGTTATCTGTAGGAGTAACTGGG + Intergenic
1105996516 13:25677772-25677794 TGTTCTCTTTTTGAGGACAAAGG - Intronic
1106151302 13:27105607-27105629 TGTTAGCTGTTGAAGAAACAAGG - Intronic
1106251031 13:27981574-27981596 TGTTCTATGGGAGAGGAACAGGG + Intronic
1107282752 13:38755397-38755419 TATTCTCTATTGAAGGAAAAGGG + Intronic
1109382253 13:61578364-61578386 TCTTCTCCTTTGCAGGAACATGG + Intergenic
1110676019 13:78245548-78245570 AGTTTTCTGTTAGAGGAGCATGG + Intergenic
1112003735 13:95236188-95236210 TTTTCTTTGTTGGGGGAAAAGGG - Intronic
1112677921 13:101725276-101725298 TGTTTTTTTTGGGAGGAACAGGG + Intronic
1114787100 14:25613421-25613443 TCTTGTCTTTTGCAGGAACATGG + Intergenic
1114872947 14:26679552-26679574 TGCTCTCTGCTGCAGGAATATGG - Intergenic
1116594425 14:46820868-46820890 TGTTTTCTGTTGTAGAAAAAGGG - Intergenic
1120670194 14:87354174-87354196 TGTTCTCACATGGTGGAACAAGG - Intergenic
1123965335 15:25450172-25450194 TCTTCTCTGCTGGAGTCACATGG - Intergenic
1124410771 15:29434712-29434734 TGATCTCTGCTTGAGGAGCATGG - Intronic
1125321997 15:38498854-38498876 TGTTCTCTGTGGGAGCTACTGGG + Exonic
1127475578 15:59329442-59329464 TGTGCATTGTTGGAGGAAAATGG + Intronic
1129283690 15:74506376-74506398 TGTTCTCTTTGGCAGGAACAAGG - Intergenic
1130821771 15:87503368-87503390 TGTAGTCTCTTGTAGGAACAAGG + Intergenic
1131958321 15:97761978-97762000 GTTTCTCTGATGGCGGAACATGG + Intergenic
1132506301 16:310987-311009 TGGTCTCTGAGGGAGGCACAAGG + Intronic
1133491079 16:6268814-6268836 TGTTCTCTGTTGGAGGAACAGGG - Intronic
1133554640 16:6893632-6893654 AATGCTCTATTGGAGGAACAGGG - Intronic
1133592002 16:7254200-7254222 AGTTCATTGTTGGAGAAACAAGG + Intronic
1135140464 16:19916942-19916964 TGTTCTCTCTTTTAGCAACATGG + Intergenic
1135997581 16:27263379-27263401 TGATGTCTTTTGCAGGAACATGG + Intronic
1137508387 16:49076584-49076606 TGCTCTGTGTTGGGGGACCATGG + Intergenic
1138181191 16:54941124-54941146 TGTCTTCTGTTGCAGGAACACGG - Intergenic
1138782566 16:59807170-59807192 TGTTATTTGTTGGAGAAAAAAGG - Intergenic
1143111570 17:4555758-4555780 TCTGCTCTCGTGGAGGAACACGG + Intergenic
1146195990 17:30813496-30813518 AGTTGTCAGTTGGAGGAGCAGGG + Intronic
1147735075 17:42631550-42631572 TTTTTTCTGATGGAGGAACAGGG - Intergenic
1150940819 17:69692240-69692262 TGTTTTCAGTTGGGGTAACAGGG + Intergenic
1152127121 17:78453878-78453900 TGTTTTTTGTTGGAGAGACAAGG + Intronic
1152332916 17:79684137-79684159 TGTTCCCATTTGGAGGAAGAGGG + Intergenic
1152984308 18:307943-307965 TGTTCTCTGAGGGAGGAAAGGGG + Intergenic
1156174522 18:34527500-34527522 CCTTCTCTGTAGGAGGCACAGGG - Intronic
1157431192 18:47628124-47628146 TTTTATCTGTTGCAGGAAAATGG + Intergenic
1158625567 18:59068569-59068591 TGTTCTCTTCTTGAGCAACAAGG + Intergenic
1159099088 18:63938483-63938505 TTTTCTCTTTTGTAGAAACAGGG - Intergenic
1159536317 18:69719436-69719458 TATTATCTGTTGGAGCAACTGGG + Intronic
1159902551 18:74061044-74061066 TGTTCTCTGTGGAGGGAAGAAGG - Intergenic
1159950178 18:74477314-74477336 TGTTTCCTATTGGATGAACATGG - Intergenic
1162953180 19:14083869-14083891 TGGTCTCTGCTGAAGGAAGAAGG + Exonic
1163416129 19:17187493-17187515 TGTTCTCTGTGGCAGGCACTGGG - Intronic
1164313989 19:24070815-24070837 TGTACTCTGTGACAGGAACAAGG - Intronic
1164557658 19:29266098-29266120 TGTGCTGTGCTGGAGGAGCAGGG - Intergenic
1164833984 19:31345338-31345360 CGTTCTCTCTTGGAAGCACATGG - Intronic
1165664772 19:37618838-37618860 TGTACTTAGTGGGAGGAACAGGG - Intronic
1166799216 19:45445676-45445698 TCTGGTGTGTTGGAGGAACACGG + Intronic
1167444081 19:49527224-49527246 TGTTCACTCTTGGAGGAAATGGG + Intergenic
925220057 2:2131844-2131866 CGTTCTCTGCAGGAGGTACATGG + Intronic
925740935 2:7005601-7005623 TGTTCTGTGTTCTGGGAACACGG - Intronic
925824732 2:7836614-7836636 TGTTCTCTGATGGTGGAATGCGG - Intergenic
926064938 2:9831067-9831089 TCTTCTCTCTAGCAGGAACATGG + Intergenic
928930708 2:36620782-36620804 TGTTCTCAATGGGAGTAACAGGG - Intronic
929436523 2:41932670-41932692 TGTCCTCTGTTGGAGGGAGCAGG - Intergenic
930277958 2:49335744-49335766 CCTGCTCTGCTGGAGGAACAGGG + Intergenic
931639376 2:64368522-64368544 ACTTCTCTGTTTGAGGAAAATGG + Intergenic
932058488 2:68470818-68470840 AGTCCTCAGTTGGGGGAACAGGG + Intronic
932844448 2:75120761-75120783 TCTTCTCTGTTCCAGGTACATGG - Exonic
932895009 2:75631044-75631066 TGGTCTCAGTTGGATGATCAGGG + Intergenic
934845754 2:97660513-97660535 GGTCCTCAGTTGCAGGAACATGG - Intronic
935335321 2:102010215-102010237 TGTTCACTGTTGAAGCCACATGG + Intronic
936034249 2:109098014-109098036 TTTGCTCTGTGGCAGGAACAGGG + Intergenic
937364865 2:121254213-121254235 TGTTCTCTGTTAGAATTACAGGG + Intronic
937384840 2:121419694-121419716 TTTTCTCAGATGGAGAAACAAGG - Intronic
938086065 2:128402891-128402913 TGTGCTTTGTGGGAGGAATACGG + Intergenic
941647597 2:168057914-168057936 TGTTCTCAGATGGGTGAACAGGG - Intronic
942377390 2:175351879-175351901 TGTTCTCTTTTGGAGGCTCTAGG + Intergenic
945954441 2:216072676-216072698 TCTTGTCTTTTGCAGGAACATGG - Intronic
945968357 2:216212042-216212064 TCTTCTCTGTGAGATGAACATGG - Intergenic
946046336 2:216824173-216824195 TGTACTCTGGTGGAAGAAAAAGG - Intergenic
946944795 2:224809739-224809761 TGTACACTGTTGGTGGAATACGG + Intronic
947059671 2:226149252-226149274 TTTTCTCTTTTAGAAGAACACGG + Intergenic
947462732 2:230317433-230317455 TGCTGTCTGATGGAGGAACAGGG + Intergenic
947876122 2:233469356-233469378 TCTTCTCTGTTGCAGGACCTGGG + Exonic
948502233 2:238404004-238404026 TATTTTCTGGTGCAGGAACATGG - Intergenic
1169171074 20:3466005-3466027 TGTTCTCTGTTGTAGAAATTTGG + Intergenic
1170635854 20:18103846-18103868 TGTTCTCCTTTTGAGGAAAATGG - Intergenic
1173784283 20:45781346-45781368 TCTTCTCTTTTGGTGGAACTGGG - Intronic
1176869098 21:14072502-14072524 TGTCCTCCGTGGGAGGAACCCGG + Intergenic
1177506094 21:22018898-22018920 TATTCTCTGTGGTAGGAAAAGGG + Intergenic
1177813851 21:25954498-25954520 AGTTATCTGTTTGAGGAATATGG - Intronic
1177839951 21:26224566-26224588 TATTCTCTGTAGCAGGAAAATGG + Intergenic
1177947203 21:27485575-27485597 TTTTCCCTGTTGGTGGCACAGGG + Intergenic
1179515348 21:41902772-41902794 TGTTCTCTGTGCCAGGAACCAGG - Intronic
1180006360 21:45022839-45022861 AGTTCTCTGTGGGAGAAACCAGG + Intergenic
949433091 3:3999530-3999552 TCTTGTCTTTTGCAGGAACATGG + Intronic
949868890 3:8570268-8570290 TGGTCTCTGTTCTAGGAGCAAGG + Intergenic
950621491 3:14209316-14209338 TGGTCTCTTTTGCAGGAAGAGGG - Intergenic
954465307 3:50651031-50651053 TGATCTGTGATGGAAGAACATGG + Intergenic
955046439 3:55364883-55364905 TGCTCTCTCTTTGAGAAACATGG + Intergenic
955349181 3:58181463-58181485 TGTTCTCTGTTGTATGCCCAGGG - Intergenic
956004153 3:64761129-64761151 TGTTCTCTGAAGGGGAAACAAGG - Intergenic
956057290 3:65313388-65313410 TCATCTCTTTTGCAGGAACATGG - Intergenic
956267833 3:67417709-67417731 CTTTCTCTGCTGGAGGAAAAGGG - Intronic
959111752 3:102131112-102131134 TCATGTCTGTTGCAGGAACATGG + Intronic
959123246 3:102257990-102258012 TGTTATCAGTTGGTGGAACATGG - Intronic
960905650 3:122598541-122598563 AGTTATCTGTGGGAGGAAGAGGG + Intronic
961333949 3:126159028-126159050 TGTTCCCTGATGGAGGAAGAAGG + Intronic
961496047 3:127292314-127292336 TGTTCTGAGTTGGGGCAACAGGG + Intergenic
962509910 3:136087910-136087932 TATTCTCTGGTGCAGTAACAAGG + Exonic
963237554 3:142970706-142970728 TGTTCTCAGTTGCAGGGAAATGG + Intronic
963577491 3:147079141-147079163 TGTACTCTTTTTGAGGAAAAAGG + Intergenic
963743350 3:149101264-149101286 TGTTTTATGTTAGAGAAACATGG - Intergenic
965497303 3:169413910-169413932 GGTTCTCTGTTCCAGGAAGATGG - Intronic
965631503 3:170738032-170738054 TGTTGTCATTTGGAGCAACATGG + Intronic
965729411 3:171754986-171755008 TGCTCTCAGTTGGATGAACAGGG - Intronic
965738834 3:171851356-171851378 TAGTCTCTGTTGAAGGAAAAAGG - Intronic
967446280 3:189570409-189570431 TGTTTTGTTTTGGGGGAACAGGG + Intergenic
968415820 4:432772-432794 TGCTCTCTGCTGGAGGACCTCGG - Intronic
968707415 4:2086597-2086619 TATTCTCTTCTGGAGGAAAATGG - Intronic
970051721 4:11922083-11922105 TGTCCTGTGTTGGAGTAAGAAGG - Intergenic
970307363 4:14747581-14747603 CCTTCTCTGTTTCAGGAACATGG + Intergenic
971582651 4:28362416-28362438 TGCCCTCTGCTTGAGGAACACGG - Exonic
971895662 4:32590531-32590553 TGTTCTCTAATGAAGCAACAGGG - Intergenic
976361581 4:84185049-84185071 TCTTCTCTGATGGAGGCAGAAGG + Intergenic
976771622 4:88659251-88659273 TATACTCTCTTGGAGGAGCAAGG + Intronic
977562726 4:98548829-98548851 TCTTGTCTTTTGGAGCAACATGG - Intronic
977726434 4:100302094-100302116 TGTTCTTTTTTGGGGGAAGAGGG - Intergenic
978406481 4:108384802-108384824 TGTACTTAGTGGGAGGAACAGGG - Intergenic
979936852 4:126709068-126709090 TGTTCTCAGTTTGAGTGACAGGG - Intergenic
980277488 4:130673510-130673532 TTTTCACTGTTGGAGCAATAAGG + Intergenic
982404423 4:155004065-155004087 TCTTCTCTGATGGAGGCTCAAGG + Intergenic
982939347 4:161528679-161528701 TGTTCTCTGTTGCAGGAATTCGG - Intronic
984651570 4:182275986-182276008 TGTTATGTGTTAGAGGAATAAGG + Intronic
985135561 4:186782533-186782555 TGTCCTCAGTTGGTGGAAAAGGG - Intergenic
985255171 4:188062983-188063005 TGTTGTGTGTTTGAAGAACAGGG + Intergenic
986082742 5:4411005-4411027 AGTTCTCTCCTGGAGGCACATGG - Intergenic
987123936 5:14793505-14793527 AGTTCTCTGGTGGAGCAGCAAGG + Intronic
987526580 5:19058135-19058157 TGTTTTCTCTTGATGGAACAAGG - Intergenic
987658558 5:20841326-20841348 TCATATCTGTTGCAGGAACATGG + Intergenic
988128157 5:27070085-27070107 TTTTCTCAGTTGAATGAACATGG - Intronic
988765127 5:34364607-34364629 TCATATCTGTTGCAGGAACATGG - Intergenic
988961229 5:36373587-36373609 TGTTCTCTGGTTGCGCAACATGG + Intergenic
993466355 5:88251298-88251320 TGTTATCTGTAGGAGTAACTGGG + Intronic
994106704 5:95958172-95958194 TGTTCTCTCTGGGGGGAAAATGG - Intronic
994248813 5:97512867-97512889 TTTTCTTTGCTGGAGGAACGAGG - Intergenic
995531387 5:113095154-113095176 TGTCCTCTGTTACAGCAACATGG - Intronic
995961248 5:117842506-117842528 TGATGTCTTTTGCAGGAACATGG + Intergenic
996302042 5:121998927-121998949 TGTTCTCAAGTGGAGCAACATGG - Intronic
996568395 5:124906354-124906376 AGTTCTCTTATGCAGGAACAAGG + Intergenic
996644210 5:125794897-125794919 TGTACTCTTTTGTAGGAACAAGG - Intergenic
996968976 5:129340570-129340592 TCTTGTCTGTTGGAGGAGCAAGG + Intergenic
997419418 5:133754069-133754091 TCTCCACTGTTGGCGGAACATGG - Intergenic
997515644 5:134487429-134487451 TGTCCTGTGTTGGATGAAAATGG + Intergenic
997793053 5:136779826-136779848 TTCTCTCTGTTGAAAGAACAGGG - Intergenic
998369326 5:141650929-141650951 TGTGCTGGGGTGGAGGAACAGGG - Intronic
1000069873 5:157730448-157730470 TTTTCTTTTTTGTAGGAACAGGG + Intergenic
1000346801 5:160321298-160321320 TATTGTCTGTTGGAGGAGCAGGG - Intronic
1002110531 5:176907170-176907192 TTTTCTCTGTTACAGGAAAAAGG - Exonic
1003304590 6:4914843-4914865 TGTTCACAGTTGTGGGAACAGGG + Intronic
1004142077 6:13027439-13027461 TGGTTTCTGTTGCAGTAACATGG - Intronic
1008806329 6:55433400-55433422 TCTTCTCTGTTTTTGGAACAAGG - Intergenic
1008987071 6:57557453-57557475 TCTTGTCTTTTGCAGGAACATGG + Intronic
1010622674 6:78096108-78096130 TGTTCTCTGATGCAGGAAGTGGG - Intergenic
1012744653 6:103070130-103070152 TGATGTCTTTTGTAGGAACATGG - Intergenic
1013576355 6:111486788-111486810 TGCTTTCTTTTTGAGGAACAGGG + Intergenic
1015288869 6:131515169-131515191 TCTTGTCTTTTGTAGGAACATGG - Intergenic
1016073820 6:139772717-139772739 TGCTCTATGTTGAAGGAACAAGG - Intergenic
1017362890 6:153596802-153596824 TGTGGTCTGTTGGAGAAAGATGG - Intergenic
1018622451 6:165743659-165743681 TGTTATCTGTCAGAGGAAGAGGG - Intronic
1019094656 6:169569034-169569056 CGTTCTCTGTTGATGGAAGAGGG - Intronic
1019638784 7:2091244-2091266 TGTTCTCGGTAGGAGGACCTGGG - Intronic
1019797780 7:3064500-3064522 TGTTATCTGTTGCAGGCAAAGGG + Intergenic
1020777029 7:12467786-12467808 TGAGCTCTTTTAGAGGAACAGGG - Intergenic
1023669610 7:42561731-42561753 TGTTGGCTGTTGGGGGAGCATGG + Intergenic
1026315629 7:69224840-69224862 TGTTCCCTGTTGGAGGATTATGG - Intergenic
1027407621 7:77878437-77878459 TGTTATCTGTAGGAGCAACTGGG + Intronic
1027516018 7:79142830-79142852 GCTTCTCTGCTGGTGGAACAGGG - Intronic
1028501224 7:91520811-91520833 TGCTCTCTGTTGGTGGAGCCTGG - Intergenic
1031350239 7:120722221-120722243 TGTCCTGTGTTGGAAGCACAGGG - Intronic
1031444740 7:121837773-121837795 TGTTCTATGTTTGAGAAAAAGGG - Intergenic
1033056004 7:138055025-138055047 TGATCTTTGTTGAAGGAGCAAGG + Intronic
1033566185 7:142580429-142580451 TGTTCTCTGCATGAGGAGCATGG + Intergenic
1035307891 7:157945094-157945116 TGTTTAGTGTGGGAGGAACACGG + Intronic
1035518662 8:258307-258329 TGTTTTCTGTTGTAGAGACATGG - Intergenic
1039220533 8:35325757-35325779 TGTTCTCAGGTGGAGGAAGGGGG + Intronic
1040597462 8:48853142-48853164 TGTTTTCTATTAGAGGAACCAGG - Intergenic
1041404375 8:57482233-57482255 TGTTCTGTGTTTGAGGATTATGG + Intergenic
1041521448 8:58761004-58761026 TGATGTCTTTTGCAGGAACATGG - Intergenic
1041812485 8:61927235-61927257 TGTTCTTTGTTGGAGACTCAGGG - Intergenic
1042724853 8:71862360-71862382 TGTTCTTTCTTGGTGGATCAGGG + Intronic
1043331712 8:79124639-79124661 TGTTCTCTGTGTTAGAAACAAGG - Intergenic
1045723959 8:105148942-105148964 TGTTGTCTTTTGCAGCAACATGG - Intronic
1046595555 8:116257199-116257221 TGGTCTCTGTTAGAATAACATGG - Intergenic
1047292605 8:123542624-123542646 TGGTCTCTGTTGGAGGGAATTGG + Intergenic
1050289286 9:4137336-4137358 TGTTCTTTGTGGGATAAACATGG - Intronic
1050698907 9:8314581-8314603 TGATCTCTGCTGGAGTATCAGGG + Exonic
1051500845 9:17776108-17776130 TGTTCCCTGCTGGAAGAGCAAGG - Intronic
1051681323 9:19610935-19610957 CCTGCTCTGTTGGAGGAATAAGG + Intronic
1051899533 9:22024304-22024326 TCTACTTTGTTGGAGGACCAAGG + Intronic
1052098579 9:24414518-24414540 TTTTCTCTGATGGTTGAACAAGG - Intergenic
1052626807 9:30985874-30985896 TGTTGTCTTTTGCAGGAACACGG + Intergenic
1053416417 9:37949652-37949674 TTTTCTCTGTTTGAGCAACATGG + Intronic
1060015241 9:120081038-120081060 TGTTCTGTGTAGGGGGAAGAAGG + Intergenic
1060070172 9:120540059-120540081 TGTTTTATGTTAGAGTAACACGG - Intronic
1060806561 9:126581332-126581354 TGGTCTGTGTAGGAGGATCAGGG - Intergenic
1062521963 9:136961667-136961689 TGTTTTCTGCAGGAGGAAGAAGG + Intergenic
1186317783 X:8389177-8389199 TCTTCTCTGTTGGAGAAGGAGGG + Intergenic
1188839416 X:34997174-34997196 TGTACTTGGTGGGAGGAACAGGG + Intergenic
1188992600 X:36840843-36840865 TGTTTTTTTTTGCAGGAACATGG - Intergenic
1190897346 X:54633752-54633774 TGTTGGCTGTTGGAGGAGCATGG - Intergenic
1191251296 X:58261392-58261414 TGTTTTCCGTGGGAGGAACCAGG - Intergenic
1191643941 X:63458400-63458422 TGTCCTTAGTTGGAGGATCATGG + Intergenic
1191910139 X:66141316-66141338 TTTTGTCTTTTGCAGGAACATGG - Intergenic
1192718515 X:73668414-73668436 TGTGGTCATTTGGAGGAACAGGG + Intronic
1193219258 X:78902889-78902911 TCATGTCTTTTGGAGGAACATGG + Intergenic
1194456097 X:94105571-94105593 TCTTGTCTTTTGGAGGGACATGG - Intergenic
1197751429 X:129966492-129966514 CGGTCTCTGATGGAGCAACAAGG + Intergenic
1199852438 X:151735286-151735308 TGTTCTCTTTGGTAGGTACATGG + Intergenic
1200234700 X:154462626-154462648 GGTCCTCTGTTGAATGAACAAGG + Intronic