ID: 1133491176

View in Genome Browser
Species Human (GRCh38)
Location 16:6270271-6270293
Sequence ACTCTAACAATCTCTTACAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133491176 Original CRISPR ACTCTAACAATCTCTTACAA AGG (reversed) Intronic
911243329 1:95489259-95489281 AATTTAACAATCTATTACACTGG + Intergenic
913218937 1:116644039-116644061 ACTGTGACAATCCCTTAGAAAGG + Intronic
922464397 1:225836890-225836912 ACACTTACAATCTGTTAAAAGGG + Intronic
923432098 1:233932633-233932655 AATTTAAAAATCTCTTAAAAAGG + Intronic
924714433 1:246559578-246559600 ATTTTAACAATCACTTTCAAGGG + Intronic
1063711772 10:8486192-8486214 AGTCTGACAGTTTCTTACAAAGG + Intergenic
1065766158 10:29031711-29031733 ACTTTAAAAATCACTTACATAGG + Intergenic
1067354071 10:45507939-45507961 TATCTTACAATCTCTTACTAAGG - Intronic
1067514284 10:46923860-46923882 ACTCTACCAAACTTTGACAAAGG - Intronic
1067647971 10:48127949-48127971 ACTCTACCAAACTTTGACAAAGG + Intergenic
1076269398 10:129137795-129137817 ATTCTAAATATCTCTCACAAGGG - Intergenic
1078240623 11:9527783-9527805 ACTCTGAGAATCTATTCCAAGGG - Exonic
1080354226 11:31423021-31423043 AATCTAACAATTTCTGAAAAAGG - Intronic
1083962671 11:66023006-66023028 ACTCTACCAATCTCTTCCAGTGG - Exonic
1088058022 11:105609713-105609735 CCTCTAACATTCTCTTGGAAAGG - Intergenic
1088505203 11:110520751-110520773 AATGTAACAAACTCTTACATGGG + Intergenic
1092695538 12:11167323-11167345 ATTTTAACAAATTCTTACAAAGG - Intronic
1093443871 12:19231151-19231173 CCTCAAAGAAACTCTTACAATGG - Intronic
1094309054 12:29057453-29057475 ACTCTAACAACCTATTTCCAGGG + Intergenic
1094816335 12:34189361-34189383 ACACTAACAATTTTTTAGAAAGG + Intergenic
1097597389 12:61650898-61650920 ACTGGAACAAACACTTACAAAGG + Intergenic
1098459546 12:70717476-70717498 ACTCTAACAAAGGATTACAAGGG + Intronic
1099106579 12:78504628-78504650 ACCATAACAATCTCTTTCACAGG - Intergenic
1099994796 12:89766880-89766902 ACTCTATCAAACTCTTTAAATGG - Intergenic
1100147957 12:91700275-91700297 ACTCTTACATACTCTTACAGAGG + Intergenic
1108497463 13:51039778-51039800 CCTCTAACAAGCTTTTACATTGG + Intergenic
1109113208 13:58349871-58349893 ACTCTGAATATCTCTTATAATGG - Intergenic
1110170093 13:72490305-72490327 AATCTAACAACATCTTCCAAAGG - Intergenic
1115718553 14:36133661-36133683 AATCTAACTTTCTCTTTCAATGG + Intergenic
1116175143 14:41459732-41459754 AATCTAAGAATCCCTTAAAATGG - Intergenic
1116379152 14:44243292-44243314 AGTCTACCAATCTTTGACAAAGG + Intergenic
1118991982 14:70805505-70805527 ACTCTAACAAGTACCTACAATGG + Intronic
1120093186 14:80357795-80357817 ACTAAAACAATCTCTTTTAATGG + Intronic
1123781718 15:23634620-23634642 ACTCATACAGTCTCTTAAAAAGG + Intergenic
1133491176 16:6270271-6270293 ACTCTAACAATCTCTTACAAAGG - Intronic
1140596208 16:76417156-76417178 ACTCTGACAATCTCTTTAATTGG + Intronic
1146247284 17:31299172-31299194 ATTCTAACAATCTCTTACACTGG + Intronic
1146779151 17:35651443-35651465 ACTCTAATAAACTCTTACAATGG + Intronic
1165495455 19:36150045-36150067 ACTCTAACAAGCTCTGTCCACGG + Exonic
927876936 2:26663669-26663691 AGTTTAGCAATTTCTTACAAAGG - Intergenic
929626794 2:43417416-43417438 ACACTGAGAATTTCTTACAAAGG - Intronic
937598630 2:123701827-123701849 ACTCTAAAAGTTTCTTCCAAAGG - Intergenic
939440782 2:142246639-142246661 ACTCAAACAACGTGTTACAATGG + Intergenic
939730005 2:145772242-145772264 ACTCTCCCTATCTCTTACAAAGG + Intergenic
939866744 2:147481483-147481505 ACTGTAACAATGGCTTGCAAAGG - Intergenic
939894850 2:147778904-147778926 ACTCTATCATTCTGTTTCAAAGG + Intergenic
940264190 2:151819201-151819223 ACTCTCTCAGTTTCTTACAAGGG + Intronic
940562696 2:155321369-155321391 ACCCTACCAATCTTTTATAAAGG + Intergenic
941796175 2:169601207-169601229 ACACTCAAAATATCTTACAATGG - Intronic
941821418 2:169847168-169847190 AGTCTTAAAATCTCTGACAATGG + Intronic
942662446 2:178280862-178280884 AATCTATCCATCTCTGACAAAGG - Intronic
943745496 2:191457509-191457531 AGTCTAACAAGATATTACAAGGG - Intergenic
943825907 2:192391691-192391713 ACTCTAATAACCACTTTCAATGG - Intergenic
944980390 2:205111763-205111785 ACTATAAAAATATGTTACAAAGG + Intronic
945579250 2:211572346-211572368 ACGCTAACAATCTGTGACATTGG + Intronic
946080547 2:217114776-217114798 ACTCAAATAATCCCCTACAAAGG + Intergenic
1175073838 20:56357518-56357540 ACTCAACCAAGCTCTTACACAGG - Intergenic
1175509453 20:59513960-59513982 ACTATAAAAATCTCTTTCAGTGG + Intergenic
1176888252 21:14282431-14282453 AATCTAAGAATCTCTTAAAGAGG + Intergenic
1178237549 21:30859899-30859921 ACTAAAACAATCTCTCAGAAAGG + Intergenic
1180171680 21:46062294-46062316 AATCTAAGAATGGCTTACAACGG - Intergenic
950969664 3:17173741-17173763 TCTTTAACAATCTCATATAAGGG + Intronic
951079774 3:18439243-18439265 ATTCTAATAACCTCTTTCAATGG - Intronic
952190337 3:31016390-31016412 ACTATCACAATCTCTGACTATGG - Intergenic
952617909 3:35297503-35297525 CCTCTAACAATGTCCTACAAAGG - Intergenic
952951293 3:38527523-38527545 ACACTAACAAACTTTTTCAAAGG - Intronic
955013245 3:55040730-55040752 ACTCCAACAATTTCTTATACAGG + Intronic
957400025 3:79699528-79699550 CCTCTCACAGTCTCTTCCAAAGG + Intronic
960158603 3:114323988-114324010 ACTCTAAACAGCTCTTACAAAGG + Intergenic
960374849 3:116887415-116887437 ACTTTAAAAATATCTTACAAAGG - Intronic
965922666 3:173937636-173937658 TCTCTAACCATCACTTACTAAGG - Intronic
967358853 3:188606694-188606716 ACTCCAACATTCTATTACAGAGG + Intronic
967589789 3:191259743-191259765 CCTCAGGCAATCTCTTACAAAGG + Intronic
967833192 3:193939857-193939879 ACTCTTTCAATCCCTGACAATGG - Intergenic
970017181 4:11525195-11525217 ATTCTAACAAGTTCTTACAGGGG + Intergenic
973851506 4:54965794-54965816 ATTGTAACAATCTCTAAGAATGG + Intergenic
977742843 4:100507429-100507451 ACTCTAACACTTTCCTAGAAAGG + Intronic
983665994 4:170183941-170183963 ATTCTGACAATCATTTACAATGG + Intergenic
986448714 5:7846026-7846048 GCTCTAATAATCACTAACAAAGG + Intronic
986591692 5:9376928-9376950 ATTCGAATAATCTCTTTCAACGG + Intronic
986880233 5:12160850-12160872 ACTCTTCCAATCTCTACCAACGG - Intergenic
989690619 5:44138856-44138878 AATCTAATAATCTTTTAAAATGG - Intergenic
995962205 5:117855785-117855807 ATACTAAAAATATCTTACAAGGG + Intergenic
996113569 5:119593746-119593768 TTTCTATCAAGCTCTTACAATGG - Intronic
997914127 5:137907191-137907213 ACTCCACTAATATCTTACAAAGG + Intronic
999972911 5:156883010-156883032 ACCCTAACAATCTCCTCCAGAGG + Intergenic
1002367865 5:178727326-178727348 CCTCTACCCATCTCTTACAGTGG - Intronic
1003517896 6:6833006-6833028 ACTTCCACAATCTATTACAATGG - Intergenic
1004006163 6:11638979-11639001 ACTCTAATTATCTCTTTCTATGG + Intergenic
1004616311 6:17293659-17293681 ACTTGAACAATTTCATACAAGGG + Exonic
1005727156 6:28660710-28660732 ACCTTAACAATTTCTTAAAAAGG + Intergenic
1008811193 6:55501590-55501612 TCTCCAACAATCTATTACAGTGG + Intronic
1010759299 6:79703996-79704018 ACTCTGACAATCTCAAACATTGG - Intergenic
1011103480 6:83751321-83751343 ATTCTAATATTCTCTTATAATGG - Intergenic
1011480348 6:87787578-87787600 ACTCTAACAAGTTCTTCCACAGG - Intergenic
1018620841 6:165728075-165728097 ACTCTAACATTGTCTGAAAAGGG - Intronic
1020864604 7:13542293-13542315 ACTGTAACAATCTTTTAACATGG + Intergenic
1021426905 7:20510566-20510588 TCTCTAGCACTCTCTTGCAATGG - Intergenic
1023470560 7:40513625-40513647 ACTCTACCATCCTCTTACACAGG + Intronic
1023631388 7:42167630-42167652 ACTCTGGCAATTTCTTAAAAAGG + Intronic
1024190250 7:46999403-46999425 ACTATAACATTCTATTATAATGG - Intergenic
1024828976 7:53425950-53425972 ACTGTCTCATTCTCTTACAATGG - Intergenic
1031217709 7:118918345-118918367 ATTTTAACAATTTCTTATAATGG + Intergenic
1031552011 7:123126210-123126232 GCTCTAACCATATCATACAAAGG + Intronic
1036081106 8:5556738-5556760 AAGCTAACAAACTCTTACGATGG - Intergenic
1039725617 8:40212816-40212838 ACTCTAAGAATTTCTTAAACAGG + Intergenic
1043068383 8:75606055-75606077 ACACAAACAAACTCTAACAATGG - Intergenic
1045354539 8:101374001-101374023 ACCCTAACAATCTCTGCCGACGG + Intergenic
1045446671 8:102272997-102273019 ATTCTAACACTTTCTTTCAAAGG + Intronic
1046545956 8:115650230-115650252 AATCCAACTATCTCTTTCAAAGG + Intronic
1048488988 8:134874532-134874554 ACTTTTATAATCACTTACAAAGG - Intergenic
1051834994 9:21325645-21325667 AGCCTTACAATCTCTTATAATGG - Intergenic
1057077515 9:92146426-92146448 ACTCTTAGAATCTATTAGAAAGG - Intergenic
1058155229 9:101507259-101507281 ACTCTATCTATCTGTTACAATGG + Intronic
1059380123 9:113916880-113916902 ACTTGAACAATCTCTTAAGAAGG - Intronic
1060516829 9:124271181-124271203 ACTGCAACAATCTCTGGCAATGG - Intronic
1060680469 9:125558526-125558548 TCTGTAACAATCTCAAACAAAGG + Intronic
1194560737 X:95416663-95416685 AGTTTATCAATCTCTTAAAAGGG + Intergenic
1195858396 X:109355354-109355376 GCTCCAACAATATCTGACAAAGG + Intergenic
1198443254 X:136685049-136685071 ACTCAATCAATCTTTTACTAGGG + Intronic
1200894342 Y:8358857-8358879 ACTCAAATAATATGTTACAATGG + Intergenic