ID: 1133492753

View in Genome Browser
Species Human (GRCh38)
Location 16:6286581-6286603
Sequence AGTAACAACCACACTTATTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133492753_1133492754 18 Left 1133492753 16:6286581-6286603 CCTTAATAAGTGTGGTTGTTACT 0: 1
1: 0
2: 0
3: 6
4: 115
Right 1133492754 16:6286622-6286644 GACTTCTCCATAGCCTTGCCTGG 0: 1
1: 0
2: 0
3: 19
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133492753 Original CRISPR AGTAACAACCACACTTATTA AGG (reversed) Intronic
903035396 1:20489608-20489630 AATAACAACCACTTTTATTGAGG - Intergenic
904655800 1:32046084-32046106 AGTACCAGCCATACTAATTATGG - Intronic
905279403 1:36839307-36839329 AGTAATAACTATAATTATTATGG - Intronic
909067516 1:70953337-70953359 AGGAACAACCATACTTCTTTAGG + Intronic
916436164 1:164779919-164779941 AGTAAGAACCACAGTAAATAAGG + Intronic
916519135 1:165547537-165547559 AGGAAGAACCAGACTGATTAAGG - Intronic
918799118 1:188948876-188948898 AATAACAACACCAGTTATTAAGG - Intergenic
919310108 1:195896194-195896216 AGTAAGATCCACCCTTAATATGG - Intergenic
920766826 1:208841606-208841628 ATTAACAACCACAATTAATGGGG - Intergenic
920891374 1:209989416-209989438 AGTAAAAACAAAATTTATTAAGG + Intronic
921620411 1:217320177-217320199 AATAACAACTGCACTTATTGAGG - Intergenic
1074302734 10:112247745-112247767 AGTAACAATCATGCTTTTTAGGG + Intergenic
1074741630 10:116490430-116490452 AGCAACAACAACATGTATTAAGG + Intergenic
1075197398 10:120372236-120372258 AGCAACAAACACACATTTTATGG - Intergenic
1075449749 10:122542548-122542570 AGTAACTACTACACTCATTTGGG - Intergenic
1076459848 10:130634413-130634435 AGGAACAACCAGACCTATGATGG - Intergenic
1080047977 11:27829266-27829288 AGAAACAAACACACTCAATATGG + Intergenic
1086902575 11:92384287-92384309 AAGAACAGACACACTTATTAAGG - Intronic
1087259010 11:95989881-95989903 TATAACAACCACACTTTTAAAGG - Intronic
1087366462 11:97225987-97226009 AGTAATCTCCACACATATTATGG + Intergenic
1092819327 12:12338623-12338645 AGGAAAAACTTCACTTATTATGG + Intronic
1093244840 12:16723428-16723450 TGCAACAACCACACTGATTCTGG - Intergenic
1095731947 12:45515742-45515764 AGGAACAACCAGACATATTTGGG - Intergenic
1097523074 12:60692516-60692538 AGTAAAAACCTCACTTCTGATGG - Intergenic
1097564203 12:61248185-61248207 ATTAACAACAACACTAATCAAGG + Intergenic
1097868608 12:64580918-64580940 AGTCACAACCACACGTACCAGGG + Intergenic
1098095246 12:66947445-66947467 AGCAACAATCACAGTGATTAAGG - Intergenic
1100871854 12:98917925-98917947 TGTAACCCCAACACTTATTATGG - Intronic
1103128828 12:118448790-118448812 AGTAACAACCACCCCCATGATGG - Intergenic
1109163474 13:59004395-59004417 AGTCACCACCACACTTAATGGGG + Intergenic
1110899020 13:80797232-80797254 AGTAAGCACTACACTTTTTATGG + Intergenic
1111027564 13:82551321-82551343 GGTAACACCCACATTTTTTAAGG - Intergenic
1111117666 13:83802064-83802086 AGGTACATCCACACTTATTAAGG - Intergenic
1112480377 13:99769889-99769911 AGTCACAAGCACACTAATCATGG + Intronic
1120720396 14:87884197-87884219 AATAAAAACAGCACTTATTAAGG + Intronic
1128408440 15:67367988-67368010 AGTAAAAACCACATTGACTAGGG + Intronic
1130804926 15:87309979-87310001 AGTACCAACCACCGTTATCATGG - Intergenic
1132372073 15:101306243-101306265 AGTGGCAACCACACTTTTTTGGG + Intronic
1133492753 16:6286581-6286603 AGTAACAACCACACTTATTAAGG - Intronic
1134901838 16:17945154-17945176 AGTAACAACCACAATTGTATTGG + Intergenic
1138981832 16:62279159-62279181 AGAAACACACACACTTATTAAGG - Intergenic
1140129585 16:72148768-72148790 AGTCTCCACCACACTTATGAAGG - Intronic
1140974767 16:80048920-80048942 ATCAACAACAACATTTATTAAGG + Intergenic
1147652070 17:42068456-42068478 AATAACAACCCCATTTATTGAGG + Intergenic
1155415514 18:25594961-25594983 TTTACCAACCACACTTATTTTGG + Intergenic
1161498474 19:4600021-4600043 AGTAACAATAACATTTATAAAGG - Intergenic
1164679118 19:30122180-30122202 AGTAACAATCACCCTTGTAATGG - Intergenic
927328957 2:21840365-21840387 AATAAAAGCCACACTTGTTAGGG - Intergenic
929108827 2:38389241-38389263 AGAAATAACCACACTTGCTATGG + Intergenic
930517269 2:52423853-52423875 AGGAACAACCAGAGTTACTATGG - Intergenic
937037894 2:118796930-118796952 AGTAACAACTACCCTTCTTCAGG + Intergenic
937541169 2:122956037-122956059 AGTAACAAACCCATTGATTAAGG + Intergenic
940922500 2:159324412-159324434 AGTATCAACCACACGTCATATGG - Intronic
943370700 2:187012023-187012045 TGTAACAACCACTCTTCATATGG - Intergenic
943981141 2:194552395-194552417 AGTAACAAGCACAGTTGTCATGG + Intergenic
944395432 2:199261321-199261343 AGTAACCACCTCACATATTTAGG - Intergenic
945598642 2:211829711-211829733 AGAAACAACCTGACATATTAAGG - Intronic
946521760 2:220472965-220472987 GGTAACAAGCACAATTATCAGGG - Intergenic
947261487 2:228228302-228228324 AGTAACTATCACACTAATTTCGG - Intergenic
1174833291 20:53833527-53833549 AGTAACAAAGACACGTATTGTGG - Intergenic
1177532656 21:22381929-22381951 AATAACAAGAAAACTTATTAAGG + Intergenic
1178706832 21:34882571-34882593 GGCAACAAACACACTTATAATGG - Intronic
1179594725 21:42434989-42435011 AATAACAGCAACACTGATTATGG + Intronic
949539165 3:5018821-5018843 AGTAGCAACCCCACTACTTATGG + Intergenic
950497459 3:13342350-13342372 AGTAACTAATACACTAATTAGGG + Intronic
952678296 3:36060138-36060160 AAAAACAACCACACATATCAGGG - Intergenic
952699942 3:36316888-36316910 AGCCAAAACCACACTTATTCTGG - Intergenic
959335017 3:105053207-105053229 AAGGACAACCACACTTATAATGG + Intergenic
959765209 3:110018711-110018733 GGTAATAACCACAGTTGTTATGG - Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
966812180 3:183856512-183856534 AGTATCCACCAAACTAATTAAGG + Intronic
971686369 4:29774505-29774527 AGTCATAACCATACTTATGAGGG - Intergenic
974380199 4:61129915-61129937 AGTAACTAGTACACTTACTAAGG - Intergenic
976485386 4:85596432-85596454 TGGAACAACAACACTTTTTATGG - Intronic
976614835 4:87065834-87065856 AGTACCAAAAACATTTATTAAGG - Intronic
976778603 4:88734040-88734062 AGTATCTACAACACTTATGATGG - Intronic
978854654 4:113380691-113380713 AGTAACCACCAGTCTTATAAGGG + Intronic
982771755 4:159402800-159402822 AGTGACAACCACATTTTTGAAGG - Intergenic
984274872 4:177597542-177597564 AATAACAAACACTCTTTTTAGGG - Intergenic
987131035 5:14860366-14860388 ACAAATAACCACACTTAATAAGG - Intronic
988809610 5:34771515-34771537 AATAACAAACACAATTATTCTGG - Intronic
989105122 5:37855927-37855949 ATTAAGAATCACAATTATTAGGG - Intergenic
995731755 5:115251299-115251321 TGTAACAAACAAAATTATTATGG + Intronic
996590388 5:125140255-125140277 AGAAAAAACAACATTTATTAAGG - Intergenic
996797559 5:127365894-127365916 TGGGACAACCACACTTATAATGG + Intronic
1003754158 6:9097265-9097287 TGTAACCACCACACTGGTTAAGG + Intergenic
1007703677 6:43778777-43778799 AGTAAAAACAGCATTTATTATGG - Intronic
1008434159 6:51455758-51455780 AGCAATAACCAATCTTATTATGG + Intergenic
1011631459 6:89329782-89329804 AGAGACAACCACACTGATCATGG - Exonic
1011894906 6:92213590-92213612 ACTTAAAACCAAACTTATTATGG + Intergenic
1013939252 6:115641926-115641948 ACTAAAAACTACACTTATAAAGG + Intergenic
1017129444 6:151095398-151095420 AGAATCAAACACACTTATTCTGG - Intronic
1020487660 7:8738949-8738971 AGGAACATCCACAATTATTGAGG - Intronic
1020973680 7:14980069-14980091 AGTGACAAACTCAATTATTAGGG + Intergenic
1026357546 7:69572135-69572157 AATAACAACCATACCTATAAGGG - Intergenic
1027363640 7:77434438-77434460 TGTAATAACCGCACTTATTTAGG - Intergenic
1028637926 7:93011465-93011487 AGTAAAAAGCACAATAATTAGGG - Intergenic
1030681478 7:112439002-112439024 AGTAACAAACAACCCTATTAAGG + Intronic
1033612086 7:142973120-142973142 AGTAACCACTAAATTTATTAGGG + Intergenic
1035112965 7:156499597-156499619 TCTAATAACCACAATTATTAAGG + Intergenic
1037462766 8:19129741-19129763 AGTAAGAATCACAATTATTCAGG - Intergenic
1039054436 8:33524163-33524185 AATAACAACAACTTTTATTATGG - Intergenic
1041480011 8:58309346-58309368 GGTAATAACCACAGTTGTTATGG + Intergenic
1042367875 8:67957298-67957320 GGTAACAACCACAGTTAGTATGG + Intronic
1047898624 8:129395566-129395588 AGTAACAATAACACTGATAAGGG - Intergenic
1048459581 8:134610489-134610511 AGTTAAAACCACACTTATGATGG + Exonic
1048593268 8:135841295-135841317 ACAAACAACCACACTTTTCATGG + Intergenic
1052177351 9:25479380-25479402 AGGAACTAACACACTTAATAGGG - Intergenic
1054955072 9:70900120-70900142 AGATACAATCATACTTATTAGGG + Intronic
1057905878 9:98983146-98983168 AGTACTAACCTCAATTATTATGG - Intronic
1058362665 9:104168071-104168093 AGCAACAACCAATCTCATTAAGG - Intergenic
1060274133 9:122169512-122169534 GGTAACTATCACAATTATTATGG - Intronic
1060303497 9:122390447-122390469 TGTAACAACCAGACTTATAATGG + Intronic
1186651959 X:11570908-11570930 AGGCACAAATACACTTATTAGGG - Intronic
1188716935 X:33470653-33470675 AGCAAAAACAAAACTTATTAGGG - Intergenic
1189905140 X:45751200-45751222 AGTAACAAACAGTCTTTTTATGG + Intergenic
1195969130 X:110455154-110455176 GGTAAGAGCCACACTTACTATGG - Intronic
1196594668 X:117530412-117530434 ATGTACAACCACATTTATTAAGG - Intergenic
1196638074 X:118027057-118027079 AGTCACAACAACAGTTATTTTGG + Intronic
1197309772 X:124890330-124890352 AGTATCAACCTCAGTGATTAGGG - Intronic
1197397516 X:125945258-125945280 ATTAACAACCACACAGATTAAGG + Intergenic
1200656193 Y:5904414-5904436 AGCAACAACTCCACATATTATGG - Intergenic