ID: 1133492898

View in Genome Browser
Species Human (GRCh38)
Location 16:6288713-6288735
Sequence CTGCTGGTACAGCTGAAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1133492896_1133492898 -2 Left 1133492896 16:6288692-6288714 CCTGTATGTTGCTTACTGTCTCT 0: 1
1: 0
2: 2
3: 14
4: 297
Right 1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG 0: 1
1: 0
2: 4
3: 18
4: 187
1133492895_1133492898 -1 Left 1133492895 16:6288691-6288713 CCCTGTATGTTGCTTACTGTCTC 0: 1
1: 1
2: 3
3: 9
4: 206
Right 1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG 0: 1
1: 0
2: 4
3: 18
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1133492898 Original CRISPR CTGCTGGTACAGCTGAAGCA AGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900578617 1:3396533-3396555 CTGCTGGTGCACGTGAAGGAAGG + Exonic
902554715 1:17240152-17240174 CTGTGGGAACAGGTGAAGCAAGG + Intronic
904046921 1:27614731-27614753 CTGGAGGCACAGCTGATGCAGGG + Intronic
905482946 1:38274186-38274208 CTGCTGTTACAGTTAAAGGAAGG + Intergenic
905541850 1:38766184-38766206 CTGCTGGAACAGCAGGAGGAAGG + Intergenic
906180048 1:43810361-43810383 CTCCTGCCACAGCTGAAGCCTGG - Intronic
906989778 1:50725564-50725586 CTACTCGTATAGCTGAGGCACGG - Intronic
907267108 1:53269148-53269170 AAGCTGGTACAGTTGGAGCAAGG - Intronic
907497423 1:54854115-54854137 CTGCTCGTACAGCTTGCGCAGGG + Exonic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908676159 1:66606449-66606471 CTGCAGGTCCAGCAAAAGCACGG + Intronic
911875489 1:103157090-103157112 CTGCTGCTACTGCTGAATAATGG + Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
912867047 1:113266967-113266989 AGGCTGGTGCAGCTGAAGCGTGG - Intergenic
913520453 1:119640590-119640612 CTGTTTGCACAGCTGAATCAAGG - Intronic
913679050 1:121171250-121171272 CTGCTGGTTCAGGTGATTCAAGG + Intronic
914030883 1:143958896-143958918 CTGCTGGTTCAGGTGATTCAAGG + Intronic
914158567 1:145109066-145109088 CTGCTGGTTCAGGTGATTCAAGG - Intronic
915250766 1:154586706-154586728 CTCCTGGGACAGCAGCAGCAGGG + Intronic
919811146 1:201409530-201409552 CTGATGGTGCAACAGAAGCATGG - Intronic
920466350 1:206189788-206189810 CTGCTGGTTCAGGTGATTCAAGG + Intronic
920746482 1:208633848-208633870 CTTCTGGTCCAACTGAAGAAAGG - Intergenic
922665460 1:227465110-227465132 CTGCTGGTAGATCTGACCCATGG - Intergenic
923141414 1:231163520-231163542 CTGCTGGTACCGCTGCACGATGG - Exonic
923488066 1:234455327-234455349 CTGCAGGTACATCTGCAGAATGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
924432739 1:244010375-244010397 CTTCTGGTGCACCTGCAGCAGGG - Intergenic
1065422137 10:25556767-25556789 CTACTGGTATATCTGAAGCGTGG - Intronic
1066444077 10:35465873-35465895 CTGCTGATAATCCTGAAGCAAGG - Intronic
1067683663 10:48455086-48455108 CCGCAGGTACAGCTTCAGCAGGG + Exonic
1067706260 10:48608463-48608485 CTTCTGGAACAGGGGAAGCAGGG - Intronic
1074368393 10:112878610-112878632 CTTCAGGTACAGCTGAATCCAGG - Intergenic
1078024562 11:7682409-7682431 CAGCTGGTAAAGCTGAGGCCTGG + Intergenic
1078462206 11:11522519-11522541 GTGGTGGGACAGCTGACGCAGGG - Intronic
1078528300 11:12117403-12117425 ATGTTGGTACTGCTGCAGCAAGG - Intronic
1082768520 11:57187435-57187457 CTGCTGCCACCGCTGGAGCAAGG + Exonic
1083235729 11:61349621-61349643 CTGCTGCTACAGCTGAGGCCTGG - Exonic
1083811194 11:65107920-65107942 GTGTTGGTACTGCTGCAGCACGG - Exonic
1084274309 11:68043867-68043889 CTGCTGTTGCAGCTGCTGCAGGG - Exonic
1088849333 11:113692510-113692532 CTGCTGGTATAGCTCCAGCCTGG + Intronic
1089357237 11:117861947-117861969 TGGCTGGGACAGCTAAAGCAAGG + Intronic
1090057759 11:123438254-123438276 CTCCTGGTCCAACAGAAGCAAGG + Intergenic
1090830021 11:130414744-130414766 CTGCTGGTCCAGCTGGTACAGGG + Exonic
1091187955 11:133663516-133663538 GTGCTGGGACTGCTGAACCATGG + Intergenic
1092744903 12:11664221-11664243 CTGCTAACACAGCAGAAGCATGG - Intronic
1093030241 12:14281792-14281814 CTCCTGGTAGAATTGAAGCAAGG - Intergenic
1093281112 12:17197426-17197448 CTGCAGGTACCACTGAAGAATGG - Intergenic
1096820223 12:54227923-54227945 CTGCTTCTACATCTGCAGCAAGG - Intergenic
1097824136 12:64157221-64157243 CTGTAGGAAGAGCTGAAGCAGGG + Exonic
1098215063 12:68207138-68207160 CTGCTGGTGTAGCTGTAGCAGGG + Intronic
1099145029 12:79032092-79032114 CTGGTGGTACAGTTGAATCATGG - Intronic
1100613846 12:96215438-96215460 CAGCTGGGACACCTGAAGCTGGG + Intronic
1102002802 12:109568189-109568211 CTGCTAGTACAGCTGCTGCCTGG - Intronic
1104282632 12:127391860-127391882 CTGCTGGCAAAGCTGATGCTTGG + Intergenic
1105014043 12:132775177-132775199 CTGCTGGTTCTGCTGGAGCAGGG + Exonic
1108204521 13:48074239-48074261 CTGCTGATGCAGCTGAGGGATGG + Intronic
1112080896 13:95969014-95969036 CTGCTGGAACTGCTGCAGCATGG - Intronic
1112284552 13:98092922-98092944 CTGCTGATACATCTGAAACTGGG + Intergenic
1113548620 13:111174727-111174749 CCGCTAGCACAGCTGAGGCACGG - Intronic
1116434923 14:44886249-44886271 CTGTTGGTAGAGCTGAAAAAAGG + Intergenic
1116949168 14:50863213-50863235 ATGCTGGTGCAGCTGATCCAAGG + Intronic
1117300833 14:54425467-54425489 CTGTGGGTTCAGCTGAGGCATGG - Exonic
1118697394 14:68398131-68398153 CAGCTGGGACAGCTAAAGCTGGG + Intronic
1120409867 14:84140915-84140937 ATGCTGGCACAGCTAAGGCAGGG + Intergenic
1120507972 14:85376639-85376661 CTCCTTGTACATCAGAAGCAGGG + Intergenic
1121865538 14:97359259-97359281 CAGCTGGGACAGCTGAAGCCTGG - Intergenic
1122609295 14:102970302-102970324 CTGCTGTAACTGGTGAAGCAGGG - Intronic
1124369510 15:29095910-29095932 CTCCTAGTCCAGCTGGAGCAGGG + Intronic
1124636743 15:31370253-31370275 CTCCTGGTACTGCTGAAGCAGGG - Intronic
1127122857 15:55786382-55786404 CTGGTGGTACAGCTAAAGCACGG + Intergenic
1127735600 15:61835776-61835798 CTGCTGGCAATCCTGAAGCAGGG - Intergenic
1128563960 15:68687072-68687094 GTGCTGGTACACTGGAAGCATGG + Intronic
1129519741 15:76178142-76178164 CTGCTGGGACAGAGGAAGCCTGG + Intronic
1129591187 15:76916414-76916436 CTTCTGGTCCAGCTGCAGCATGG + Intergenic
1129946807 15:79545644-79545666 CTACTGGGACAGGTGAAGGAGGG - Intergenic
1131059268 15:89394564-89394586 CCACTGGTACAGCTGATACATGG + Intergenic
1131800809 15:96067723-96067745 CTTCTTGTACAGCTGAAAAAGGG + Intergenic
1132605656 16:792729-792751 CTGCTGCTTCAGCTGCCGCAGGG - Exonic
1132806510 16:1777539-1777561 CAGCTGGCACAGCTGAGGCAAGG + Intronic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1135712036 16:24725887-24725909 CTGCTGGAGAGGCTGAAGCAAGG + Intergenic
1136070405 16:27784018-27784040 CTGCTGGTACCACTGCAGCCTGG - Intergenic
1139202307 16:64990495-64990517 CTGCTGGTGCTGCTAATGCATGG - Intronic
1140187509 16:72788178-72788200 TTGCTGGTACTGCTGCAGTAGGG + Exonic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1141463145 16:84190145-84190167 CTGCTGCTGCTGCTGAAGCTGGG - Intergenic
1142307858 16:89295549-89295571 GTGCTGGTGCTGCTGGAGCACGG + Intronic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1146271935 17:31490285-31490307 CTACGGGTACAGATGAAGGAGGG - Intronic
1147761309 17:42799150-42799172 CTGCTGGGCCAAGTGAAGCAGGG - Exonic
1147999616 17:44380122-44380144 CTGCCGGTCCAGCTGCAGCTCGG + Exonic
1149122718 17:53189657-53189679 CTGCTGGGACAGCAGCAGCATGG - Intergenic
1150206492 17:63412500-63412522 CAGCTGGGACAGCGGCAGCAGGG - Intronic
1153456221 18:5285306-5285328 CAGCCTGTACACCTGAAGCAAGG + Intergenic
1154251431 18:12748156-12748178 CTCCTGGTACAGCTGTGGCCGGG + Intergenic
1154274076 18:12944853-12944875 CTGCTAGTACTGCTGGAGCTAGG - Intergenic
1157634383 18:49136064-49136086 CTGCTGGTACAATTAGAGCAAGG + Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1159988711 18:74876785-74876807 CGGCTTGTACGGCTGGAGCAGGG - Intronic
1160854634 19:1211161-1211183 CTACTGGGGAAGCTGAAGCAAGG + Intronic
1161014440 19:1976687-1976709 CTGCCAGTCCAGCTGCAGCAGGG + Intronic
1161087748 19:2343021-2343043 CTGCTGTTACAACTCCAGCAGGG - Intronic
1166506515 19:43374755-43374777 TTGCTCTCACAGCTGAAGCAAGG - Intergenic
1168254401 19:55157830-55157852 CTGGTGATCCAGCTGGAGCAGGG - Intronic
925997926 2:9307051-9307073 CTGCTGGTGCAGCTGGCCCAGGG - Intronic
926489771 2:13510788-13510810 CTGAGAGTACAGTTGAAGCAAGG + Intergenic
927785388 2:25970773-25970795 CTGCTGGCCCACCTGAAGAAAGG + Intronic
928618749 2:33067807-33067829 CTGCTGGTACAGCTGTCCCCTGG - Intronic
929603555 2:43219825-43219847 CTGCTGGCACGGCTGAGGGAGGG - Intergenic
938342729 2:130546302-130546324 ATGATGGTGCAGCTGCAGCAGGG + Exonic
940788043 2:158002994-158003016 CTGCTGGTCCAGGTTAAGAATGG + Intronic
940887690 2:159003821-159003843 CTGTTGGTAAATCTGAAGCAGGG - Intronic
942860718 2:180607864-180607886 CAGGTGGTCCAGCTGAAGAAGGG + Intergenic
943273435 2:185837304-185837326 CCACATGTACAGCTGAAGCAAGG + Intergenic
946563610 2:220940043-220940065 CTACTCGGGCAGCTGAAGCAGGG + Intergenic
1168974078 20:1951117-1951139 CTGCTGGTCCAGCCGATCCATGG + Intergenic
1170892637 20:20389097-20389119 CTGGTGGTATGGCTGAAGCCGGG - Intergenic
1174046790 20:47739453-47739475 CTGGGGGTACGGCTGAGGCAGGG - Intronic
1175099568 20:56569260-56569282 CTGCTTGGGCAGCTGAGGCACGG - Intergenic
1175381757 20:58568601-58568623 CTGCTGGTGCTGCTGCAGGAGGG + Intergenic
1175501555 20:59454559-59454581 TTGCTGGCCCAGCTGAACCAGGG + Intergenic
1177037292 21:16060179-16060201 CACCTGGTCCAGCTGCAGCAGGG - Intergenic
1177158081 21:17518995-17519017 CTGTTGGTAAATCTGAAGCAGGG + Intronic
1178671267 21:34593704-34593726 CTGCTGGGCCAGCTGATGCATGG + Intronic
1179008944 21:37538446-37538468 CTACTGGGGCAGCTGAGGCAGGG - Intergenic
1179211350 21:39327136-39327158 CTGCCGGCACAGCTCTAGCAGGG + Intergenic
1179883789 21:44304842-44304864 CGGCTGCTACAGCTGAAACTGGG - Intronic
1180859114 22:19067025-19067047 ATGTTGGTGCGGCTGAAGCAGGG - Intronic
1181323552 22:22026661-22026683 CTGATCGTACAGTTTAAGCAAGG + Intergenic
1184209743 22:43028499-43028521 CAGCTGGTAGAGCTGGAACATGG - Intergenic
1185193576 22:49453982-49454004 CTGCTGGTAAAGAAGGAGCAGGG + Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950290835 3:11782998-11783020 CTGCAGCTCCAGCTGAATCATGG - Intergenic
950526645 3:13528350-13528372 CTGAAGGCACAGCTGAAGTAGGG + Intergenic
954291818 3:49653879-49653901 CAGCTCGTCCAGCTGCAGCAAGG - Exonic
954538591 3:51379438-51379460 CTGCTGGCACAGCTGAAGGGTGG - Intronic
954578934 3:51692594-51692616 CTGCTCGTACAGATGGAGCTGGG - Intronic
955467249 3:59250194-59250216 CTGCTGGCACAGAGGAAGGAGGG + Intergenic
955728525 3:61959034-61959056 CTGATGGTACTGCTGTACCATGG + Intronic
957093762 3:75758422-75758444 CAGTTGGTACAGCAGAAGGAGGG + Intronic
961848885 3:129794820-129794842 CTGCTGGGACGGCTGAAGAGGGG - Intronic
962938831 3:140107078-140107100 ATGCTGGTACAGCTGAAAAAAGG + Intronic
966548421 3:181178150-181178172 CTACTGGCAGAGCTTAAGCAGGG - Intergenic
967479214 3:189955074-189955096 TTGCTTTTACAGCTGAAGGAGGG - Intergenic
967794291 3:193581948-193581970 CAGTTGGTACAGCTGAAGCAAGG + Intronic
969857532 4:10012456-10012478 GTGCTGGCACTGCAGAAGCAAGG + Intronic
970320956 4:14874955-14874977 CTTCTGGCACAGCTGAAGGTAGG - Intergenic
972936953 4:44147835-44147857 CTGCTAGTGCAGATGATGCATGG - Intergenic
973013905 4:45111102-45111124 CAGCGGGTGCAGCCGAAGCAGGG - Intergenic
973237695 4:47923030-47923052 AAGTGGGTACAGCTGAAGCAGGG - Intronic
974242575 4:59269316-59269338 CTGCTGGTATAGCTGCAGCATGG + Intergenic
975326681 4:73066627-73066649 CTGCCAGTACTGCTTAAGCAAGG + Intronic
976221306 4:82758858-82758880 CTGCTGTGACAGCTGAAGCCAGG - Intronic
976329457 4:83812727-83812749 ATACTGGTTCAGCTGGAGCAAGG - Intergenic
976870142 4:89782216-89782238 GTGTTGGTTCAGCTAAAGCAGGG - Intronic
977774341 4:100900289-100900311 CAGTGGGTGCAGCTGAAGCAGGG + Intergenic
978776171 4:112509330-112509352 CTGCTGGGACATCTGAAGAATGG + Intergenic
978918482 4:114152797-114152819 CTGCTTCTACAGATGAAGTAAGG - Intergenic
980065729 4:128186856-128186878 CAGCTGCTCCAGCTGTAGCATGG + Intronic
982096059 4:151924558-151924580 CTGATGGTACACCTCCAGCAAGG - Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
984267182 4:177509063-177509085 CTACTGTTACATTTGAAGCATGG - Intergenic
991122844 5:63035315-63035337 CTGGAGGTACAGCTGACCCAGGG - Intergenic
995534368 5:113120376-113120398 ATGTTGGTACAGCTTAAGCCAGG - Intronic
995687325 5:114784958-114784980 CTGGTGCTACAGATGAACCAAGG - Intergenic
995727216 5:115193883-115193905 CTGCTGGGGCAGGTGAAGCTTGG + Intergenic
995965543 5:117903179-117903201 TTACTGGCACAGCTGAAGCTTGG - Intergenic
996623738 5:125542940-125542962 CTTGTGGTACATCTGTAGCATGG - Intergenic
997361464 5:133297900-133297922 CTGCTGGTCCAGATGAGGGATGG - Intronic
998512969 5:142729002-142729024 CTACAGGCACAGCTGAAGGATGG - Intergenic
1001238064 5:170046380-170046402 CTGCTTGTACTGCAGAAGCCTGG + Intronic
1001433591 5:171682522-171682544 CTGAAAGCACAGCTGAAGCAGGG - Intergenic
1002357448 5:178642249-178642271 GTGCTGCTACAGATGAAGCCTGG - Intergenic
1003702922 6:8490461-8490483 CTGCTGGTACAGGTGAGGTGCGG + Intergenic
1005082072 6:21966172-21966194 CTGCTGGTTCCGCTCCAGCAGGG - Intergenic
1012592267 6:100996602-100996624 CAGATGGTACAGCTGCAGGAAGG + Intergenic
1015848239 6:137544374-137544396 CTGTTGGTAAATCTGAAGCACGG + Intergenic
1017318339 6:153058759-153058781 ATGCTGGCTTAGCTGAAGCAGGG - Intronic
1018623123 6:165750948-165750970 CTGCTGTTACACCTGAAGGTGGG - Intronic
1020272810 7:6607258-6607280 CTGGTGGTACAGCACAACCACGG - Intronic
1020458435 7:8400804-8400826 CTTCTGGTACAGGTGACCCATGG - Intergenic
1022455934 7:30558542-30558564 CTCCTGGTACAGGGGAAGGAAGG + Intergenic
1026205020 7:68249314-68249336 CTGCTGCTACACCTGAACCATGG + Intergenic
1026324791 7:69299718-69299740 CTGCTGGAACAGAACAAGCAAGG - Intergenic
1032978635 7:137254875-137254897 CTGTGGATACTGCTGAAGCAGGG - Exonic
1033129836 7:138736133-138736155 CTGCTTGGAAGGCTGAAGCAGGG + Intronic
1034073043 7:148206532-148206554 CTGCAGGTGCTGCTGAAGAAAGG - Intronic
1034094976 7:148399228-148399250 CTGCTGGTTCTGCTGCTGCATGG - Intronic
1034815669 7:154170184-154170206 CTGCTGGGTCAGCTGCGGCAAGG - Intronic
1035308041 7:157945841-157945863 CTGATGGGACAACTGAAGCCAGG - Intronic
1035600198 8:892765-892787 TTGCTGCTACTGCTGGAGCATGG - Intergenic
1038596907 8:28895325-28895347 CTGTGGGTACTGCTGAAACAGGG + Intronic
1039443932 8:37615187-37615209 CTGCTGGTTCAGGAAAAGCAGGG + Intergenic
1040079140 8:43270190-43270212 CTGCTCTTAAAGGTGAAGCAGGG - Intergenic
1040353619 8:46593750-46593772 CTGGTGGTGGAGTTGAAGCAGGG - Intergenic
1040470046 8:47729392-47729414 CAGCTGCAACAGCAGAAGCAGGG - Exonic
1041753925 8:61292063-61292085 CTGCTGCCACTGCTGATGCATGG + Intronic
1042229473 8:66541883-66541905 GTGCGGCTACAGCTGGAGCATGG + Intergenic
1044598965 8:93984763-93984785 TTGCTTGTAAAGCTGGAGCAGGG + Intergenic
1045113100 8:98951811-98951833 CTGCAGGTGCGGCTGCAGCAAGG - Exonic
1049084872 8:140470802-140470824 CTGATGGCAAAGCTGGAGCAGGG - Intergenic
1049425097 8:142534410-142534432 CAGCTGGCACAGCTGAAGATGGG + Intronic
1055245448 9:74236327-74236349 CTGCTGCTACAGAATAAGCAGGG - Intergenic
1056878338 9:90361629-90361651 ATGTGGGTACAGCTAAAGCAAGG - Intergenic
1060793991 9:126502700-126502722 ATGCTGGCTCCGCTGAAGCAAGG - Intronic
1061768030 9:132894867-132894889 CTGGTGTTCCAGCTGAGGCAGGG - Exonic
1187311794 X:18151585-18151607 CTGCTGCTACAGCTACTGCAGGG + Intergenic
1200786849 Y:7268087-7268109 CTGCTGCTACTGCTGCAGGAAGG - Intergenic